ID: 1062043302

View in Genome Browser
Species Human (GRCh38)
Location 9:134414009-134414031
Sequence CGCTGGCGCCGGAGGCCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062043302_1062043310 22 Left 1062043302 9:134414009-134414031 CCGCCCGGCCTCCGGCGCCAGCG 0: 1
1: 0
2: 2
3: 27
4: 271
Right 1062043310 9:134414054-134414076 CGTCTAGAAGGTGATTGTGCTGG No data
1062043302_1062043309 10 Left 1062043302 9:134414009-134414031 CCGCCCGGCCTCCGGCGCCAGCG 0: 1
1: 0
2: 2
3: 27
4: 271
Right 1062043309 9:134414042-134414064 CAAGCATGACTTCGTCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062043302 Original CRISPR CGCTGGCGCCGGAGGCCGGG CGG (reversed) Intronic
900269171 1:1778415-1778437 CGCCGGCGCCGGGGTCCGGGCGG - Intronic
901086690 1:6615072-6615094 GGCTGCCGCGGGAGGGCGGGTGG + Intronic
901641263 1:10694262-10694284 CGCGGGCGGGGGAGGCCCGGGGG - Intronic
902690580 1:18108096-18108118 AGCTGGCGGCGGTGGCGGGGCGG - Exonic
902783089 1:18716929-18716951 CGCGGGCTCCCGAGGCCGGGCGG + Intronic
903455428 1:23483999-23484021 CGCTGGCGCGGGAGGAGGTGAGG - Exonic
903777121 1:25800280-25800302 CGGTGGCGCGGGAGGCTGCGCGG - Exonic
904461949 1:30685655-30685677 GGCTGGAGGCGGAGGGCGGGAGG + Intergenic
904641946 1:31937935-31937957 CGCCGGCGCCGGGGGCCTCGGGG - Intronic
905183189 1:36178853-36178875 CGCGGGCGCCGCGGGCCGGGAGG + Intronic
906517300 1:46447391-46447413 AGCTGGCGCTGGAGGTGGGGAGG - Intergenic
908195509 1:61742780-61742802 CGCTGACCCGGGAGGCGGGGCGG + Intronic
908501113 1:64744906-64744928 CGCCGGGGCCGGGGGCCGGCGGG + Intergenic
910237010 1:85047441-85047463 CGCCGGCGCGGGAGGCAGGGTGG + Intronic
910936160 1:92485619-92485641 AGCTGGCGCGGGAGGTGGGGCGG + Intronic
911188786 1:94927506-94927528 CGCTGGGCCCAGAGCCCGGGAGG - Intergenic
911498853 1:98661773-98661795 CGTTGGCGCCCCCGGCCGGGAGG - Exonic
913144514 1:115976485-115976507 CGCTGGCGGCGGGGCCGGGGCGG - Exonic
915213301 1:154325497-154325519 AGCCGGCGGCGGGGGCCGGGGGG - Intergenic
915214113 1:154328812-154328834 CCCGAGCGCCGGCGGCCGGGAGG + Intronic
915617618 1:157051656-157051678 CTCTGGAGGCTGAGGCCGGGAGG + Intergenic
916475282 1:165162987-165163009 CTCTGGTGCCGGAGGCCAGGAGG - Intergenic
920367762 1:205457050-205457072 CGCCGCCGCCGGAGGCCGCGCGG + Intergenic
921944847 1:220879560-220879582 CGCTGGGGCCGCAGGGCGGGCGG - Exonic
922739364 1:228006869-228006891 CGCCGGGGCCGGGGCCCGGGCGG - Intergenic
924436684 1:244048908-244048930 CGGCGGCGGCGGCGGCCGGGAGG + Intergenic
1063130244 10:3172147-3172169 CGCTGCCGGCCCAGGCCGGGAGG - Intronic
1064380479 10:14837854-14837876 CGCAGGGCCAGGAGGCCGGGGGG - Exonic
1067071658 10:43137346-43137368 CGCTGGAGTCGGAGGTGGGGAGG + Intergenic
1070826256 10:79392037-79392059 CGGTGGAGAGGGAGGCCGGGTGG - Intronic
1071997511 10:91162859-91162881 CGCTGGCGGCGGCGGGCGCGGGG - Intergenic
1073028908 10:100509075-100509097 CGCTGGCCCCTGAAGCCAGGAGG + Exonic
1073136727 10:101224499-101224521 CGCGGGCGCCGCAGCTCGGGTGG + Intergenic
1074086428 10:110211328-110211350 TGCTGGGGCCGGAGGCTGGGTGG + Intronic
1074104199 10:110376473-110376495 AGGTGGCGCCGGAGGCAGGAGGG - Intergenic
1075748422 10:124743970-124743992 CGGCGGCGGCGGTGGCCGGGGGG - Intronic
1076117024 10:127907631-127907653 CGCGGGGGCCGGCGGCAGGGCGG + Intronic
1076156799 10:128210968-128210990 CGCGGGCACCGGAAGCCTGGGGG - Intergenic
1076916381 10:133424704-133424726 GGCTGGTGACGGAGGACGGGAGG - Intergenic
1076936488 10:133569499-133569521 GGCTGGTGACGGAGGACGGGAGG - Intronic
1076981861 11:208942-208964 AGCGGCCGCCTGAGGCCGGGGGG + Intronic
1077136229 11:1000497-1000519 CGCTGCCGCCGGAGGAGGGTGGG - Exonic
1077230148 11:1455068-1455090 CCCTGCCCTCGGAGGCCGGGTGG + Intronic
1079714638 11:23730539-23730561 CACTCGCGCTGGAGGCGGGGAGG - Intergenic
1080387326 11:31817782-31817804 GGCCGGGGCCGGAGCCCGGGCGG + Intronic
1080573035 11:33574515-33574537 CGCTGGAGCAGGAGACTGGGAGG - Intronic
1080668536 11:34356800-34356822 CGGAGGGGCCGGAGGCGGGGAGG - Exonic
1082787596 11:57325233-57325255 TGCAGGCGGCGGAGCCCGGGAGG - Intergenic
1083448619 11:62727474-62727496 CGGGGGCGCCAGAGGGCGGGAGG - Intergenic
1083741472 11:64713719-64713741 AGCGGGGGCCGGGGGCCGGGCGG - Exonic
1083883320 11:65558711-65558733 CACTGACGATGGAGGCCGGGTGG + Intronic
1083899806 11:65638149-65638171 CGCGGGCGGCGGCGGCTGGGCGG + Intronic
1084165469 11:67373107-67373129 CGGGGGAGCCCGAGGCCGGGCGG - Intronic
1089046323 11:115504312-115504334 AGCCGGAGCCGGAGCCCGGGAGG + Exonic
1090890220 11:130916457-130916479 AGCTGTCGCCGGCGGCCGGCCGG - Exonic
1095946891 12:47758787-47758809 CCCTGTCGCCGGTGGCTGGGTGG - Intronic
1095954168 12:47797034-47797056 GGCCGCCGCCGGAGGCTGGGGGG + Exonic
1096099033 12:48957614-48957636 CGCTGGAGCTGGAGTCAGGGCGG + Intergenic
1096251089 12:50033034-50033056 CGCGGGCGTCGGGGGCAGGGAGG + Intronic
1096650625 12:53060408-53060430 CGCTGGAGCCGGTGTCCTGGAGG + Exonic
1098288563 12:68933353-68933375 TGCTGGTGCCCGCGGCCGGGCGG + Intronic
1102053621 12:109880431-109880453 CGCTGACGGCGGCGGCCGGGGGG - Exonic
1105071447 12:133236244-133236266 CGCCGGCGCCAGAGCCAGGGCGG - Intergenic
1105804580 13:23945769-23945791 CGCAGGAGCCGGAGACCTGGAGG - Intergenic
1106517086 13:30465187-30465209 CGGCGGCGGCGGCGGCCGGGCGG - Intronic
1110436462 13:75482103-75482125 CGCTGGAGCCGGCGGCCGCGGGG - Exonic
1113541816 13:111115272-111115294 CGACGGCGGCCGAGGCCGGGGGG + Exonic
1113917782 13:113884439-113884461 CGGGGGCGCCGGCAGCCGGGAGG + Intergenic
1113987294 13:114328317-114328339 AGCTGGGGCAGGAGGCAGGGCGG - Intergenic
1117819187 14:59630664-59630686 CGCTGGCGCCGCAGTCTGCGCGG + Intronic
1119492813 14:75051254-75051276 CGAGGGCCCCGGAGGCCCGGCGG - Intronic
1121377791 14:93430409-93430431 CGCCGGGGCCGGAGGGCGCGAGG - Intronic
1122081813 14:99272048-99272070 CCCTGGCGCCGCGGGCCCGGGGG + Intergenic
1122264228 14:100539219-100539241 CGCTGTCGGCGTAGGCCGGGTGG + Exonic
1122582079 14:102777383-102777405 CGCGGGCGGCGGGGGCGGGGCGG + Intergenic
1123036767 14:105474800-105474822 CGCGGGCGGCGGCGGCCCGGAGG + Intronic
1202867919 14_GL000225v1_random:135307-135329 TGCTGGCGACGGTGGCGGGGAGG + Intergenic
1123630742 15:22258203-22258225 CGCGGGCGCCGCGGGCCGGGCGG - Intergenic
1124783379 15:32656896-32656918 CACTGGCGGTGGAGGCTGGGGGG + Intronic
1125508769 15:40281977-40281999 GGCTGGCCGCGGGGGCCGGGCGG + Exonic
1126436995 15:48646245-48646267 AGCAGACGCCGGAGGCCGGGAGG + Intergenic
1127995601 15:64151798-64151820 CGGTGGGGCCCGAGGCCGAGGGG + Exonic
1127995862 15:64152766-64152788 CCCTGGCACAGAAGGCCGGGGGG - Intronic
1129986460 15:79923496-79923518 CGCGGGCGGCGGAGGCAGCGGGG - Exonic
1131374952 15:91915866-91915888 ACCTGGCACCGGAGGCCAGGTGG + Intronic
1132398161 15:101489317-101489339 CGCGCGCGCCGGAGGCCGCCGGG + Intronic
1132464820 16:72559-72581 GGCTGCCGCCGCTGGCCGGGAGG + Exonic
1132498804 16:275790-275812 TCCCGGCGCCCGAGGCCGGGAGG - Intronic
1132616183 16:842148-842170 CGCTGCCGCAGGAGGCTGAGGGG + Intergenic
1132642074 16:982519-982541 AGCTGGCGCCGGACCCCGGCTGG - Intronic
1132867772 16:2102419-2102441 GGCTGGCGCCGAAGGCGGTGAGG + Exonic
1132893073 16:2214106-2214128 CCCTGGGGCGGGAGGCTGGGGGG - Intronic
1133156610 16:3880564-3880586 GGCGGGCGCCGAGGGCCGGGCGG + Exonic
1133240121 16:4409203-4409225 CCCTGTCTCCTGAGGCCGGGAGG - Intronic
1134005828 16:10818447-10818469 TGCTGGGGCTGGAGGCGGGGCGG - Intronic
1134548897 16:15130240-15130262 GGCTGGCGCCGAAGGCGGTGAGG + Intronic
1134947976 16:18339406-18339428 GGCTGGCGCCGAAGGCGGTGAGG + Intergenic
1135382821 16:22008414-22008436 CGCTGGCGCGCCGGGCCGGGCGG + Intronic
1135517666 16:23149153-23149175 CGCTGGCGGCGGCGGCGCGGGGG - Exonic
1136580525 16:31148645-31148667 CGCTGGAGCCCGCGGCCGAGTGG - Exonic
1137585962 16:49664249-49664271 CGCCGGCCCAGGCGGCCGGGTGG - Intronic
1137617470 16:49856169-49856191 CGCAGGGGCCGGGGGCCGGCGGG - Intronic
1139426078 16:66880731-66880753 AGCCGGTGCCGCAGGCCGGGAGG - Intronic
1139473710 16:67192130-67192152 CGCTGGCTCCGGCTGCCCGGCGG + Intergenic
1139826624 16:69762400-69762422 CGCTGGCGCGGGGGGCGCGGTGG + Intronic
1139974794 16:70800979-70801001 CGCCGGCGCCGGGGGCAGAGCGG - Exonic
1141582722 16:85011321-85011343 CGCCGCCGCCGCAGGCCGGGAGG - Exonic
1141657566 16:85424247-85424269 CGCTGGCACCGGAGGGGCGGGGG - Intergenic
1141972303 16:87492370-87492392 CGCGGGCGCCGCGGGCCGGGCGG + Intergenic
1142249451 16:88984446-88984468 CCCTGGCTCTGGAGGGCGGGCGG - Intergenic
1142518813 17:491207-491229 CGCTCGCGCCGGGGCCCTGGGGG + Intergenic
1142664735 17:1456163-1456185 GGCGGGCGCCGGGGGCCGGAGGG - Exonic
1142704233 17:1684427-1684449 CGCGCGGGCCGGAGGCGGGGCGG - Intronic
1143590816 17:7885127-7885149 CGCGGGCGCGCGAAGCCGGGCGG + Intronic
1144021307 17:11241539-11241561 CGCTGCCGTCGGGGGCCGGAGGG + Exonic
1144677976 17:17173999-17174021 CCCAGGCGCTGGAGGCCGAGCGG + Exonic
1144778379 17:17796068-17796090 GGCTGGAGCCCCAGGCCGGGGGG + Exonic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1147447504 17:40483590-40483612 CGCTGGCCCCGGGGGTGGGGAGG + Intronic
1147971099 17:44219459-44219481 CGCTGGAGCGGGAAGCCCGGAGG - Intronic
1148747726 17:49927800-49927822 CGCTGGCTCGGGAGCCAGGGTGG - Intergenic
1148775886 17:50095574-50095596 GGCTGGCAGCGGAGGCCGGCGGG + Intronic
1150720348 17:67609236-67609258 AGCTGGTGTCGGAGGCCTGGTGG + Intronic
1151472337 17:74326134-74326156 GGCGGGCGCCGGGGGCGGGGCGG + Intergenic
1151492950 17:74443483-74443505 CTCTGGCCCCGGAGGGCGGATGG + Intronic
1152644676 17:81463260-81463282 GGCTGGCACTGGAGGCAGGGAGG - Intronic
1152744882 17:82034029-82034051 GGCCCCCGCCGGAGGCCGGGAGG + Exonic
1152873952 17:82775105-82775127 CGCTGGCTCGGGATCCCGGGCGG + Intronic
1152935849 17:83136302-83136324 CTCGGGCGCAGGAGGCCTGGAGG - Intergenic
1153794449 18:8609630-8609652 CGCGCGCGGCGGAGGCCGAGGGG + Exonic
1156350371 18:36297487-36297509 GGCCGGCGGCGGAGGCGGGGCGG - Intergenic
1159882385 18:73870835-73870857 CACTGGGCCCGGAGGCAGGGAGG + Intergenic
1160668351 19:344280-344302 CGCGGGCGGCGGAGGCGCGGTGG + Intronic
1160807843 19:1000478-1000500 CGCTGGGGCCGGGGTCCGCGGGG + Exonic
1160813021 19:1021090-1021112 AGATGGCGGCGGCGGCCGGGAGG - Exonic
1160859049 19:1230028-1230050 CACTGGAGCCGGACGCCGAGCGG - Exonic
1160927877 19:1555775-1555797 CGGAGGCGCCGGAGTCCAGGGGG + Exonic
1161422309 19:4182584-4182606 CGCTTCCGCCGGAAGCGGGGCGG + Exonic
1161764584 19:6199673-6199695 CGCAGGCGCAGGACGCGGGGAGG - Intergenic
1162778749 19:12995901-12995923 AGCGGGCGCGGGAGGCCGGCCGG + Intronic
1166118027 19:40667597-40667619 CGCTGGCTCAGGGGGCCAGGGGG + Exonic
1166309845 19:41956809-41956831 AGCTGGCCCGGGAGGCCGGCAGG + Exonic
1166317982 19:41999208-41999230 CGCCGGCGCCGACGCCCGGGCGG - Exonic
1166677430 19:44748505-44748527 CCCAGGCGCCGCGGGCCGGGAGG + Intronic
1166749667 19:45158896-45158918 CGCTGCCGCAGGGGGCTGGGAGG + Exonic
1168332606 19:55578992-55579014 AGCTGGCGCTGGCGGCCGGGCGG - Exonic
925928177 2:8685367-8685389 CGCTGGCGCTGGAGGAGGGCGGG + Intergenic
925969303 2:9095840-9095862 TGGCGGCGCCGGAGGCCGGAGGG + Intergenic
926320750 2:11746867-11746889 AACAGGCCCCGGAGGCCGGGAGG + Intronic
928360048 2:30655420-30655442 CGCTGTGGCTGGAGGCCGTGAGG + Intergenic
928998728 2:37324817-37324839 TCCTGGGGCCGGAGGGCGGGGGG + Intergenic
933666908 2:84971402-84971424 CACTGCAGCCGGAGCCCGGGAGG + Exonic
934678247 2:96265323-96265345 CGCCGGCGGAGGAGCCCGGGAGG - Exonic
935622817 2:105144075-105144097 CGCAGCTGCCGGGGGCCGGGAGG - Intergenic
935731064 2:106065460-106065482 CGCCGGCGGCGGGGGCCGCGTGG - Intronic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
943658706 2:190534933-190534955 CGCGTGCGCTGGAGGCCCGGAGG - Intergenic
944515735 2:200510033-200510055 CGCGGCCGCCGGACGCCGCGGGG + Exonic
946358815 2:219206810-219206832 AGCGGGCGCCGGGGGCCGGCTGG + Exonic
947632290 2:231662110-231662132 CGCAGGCGCCGGTGCGCGGGTGG - Intergenic
947635983 2:231681001-231681023 GGCAGGCGGCGGAGGCTGGGCGG + Intergenic
948874630 2:240820086-240820108 CGCGGGCGCGGGAGGCCGGGCGG + Intronic
949054695 2:241921568-241921590 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054706 2:241921608-241921630 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054717 2:241921648-241921670 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054739 2:241921728-241921750 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054764 2:241921808-241921830 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054775 2:241921848-241921870 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054787 2:241921889-241921911 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054799 2:241921929-241921951 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054811 2:241921969-241921991 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054833 2:241922049-241922071 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
949054901 2:241922287-241922309 CCCTGGGACAGGAGGCCGGGAGG + Intergenic
1168804456 20:664224-664246 CGCTCGCGGCGGCGGCGGGGCGG - Exonic
1169065684 20:2693164-2693186 CGCTGGCGCCGCGGGCGGGCGGG + Intronic
1172149246 20:32779042-32779064 CGATGGAGCCCGAGGCAGGGAGG + Intronic
1173603290 20:44311086-44311108 CGCTGGTGCGGGCGGCCGTGCGG - Exonic
1173800415 20:45891383-45891405 AGCTGGCACCGGAGGCTGGAGGG + Intronic
1175944346 20:62551702-62551724 CGCTGATGCCGGGGGCCGGGCGG + Intronic
1176194565 20:63831284-63831306 CGCGGGCGGCGGGGGCCGCGGGG - Intergenic
1176619143 21:9043121-9043143 CGCAGGCGCCGGGGGGTGGGGGG - Intergenic
1180622538 22:17171683-17171705 CGCTGGGGACGGCGGCCGGAGGG - Intergenic
1182273010 22:29167563-29167585 CACTGGGGCCGGATGCCGGTGGG - Exonic
1183093760 22:35540497-35540519 CGCTGGCGCTGGGCGGCGGGAGG + Intergenic
1183453003 22:37906698-37906720 CGACGGCCCCGGACGCCGGGCGG + Intronic
1183553435 22:38506746-38506768 CTCTGGCGCCAGAGGCCGGGAGG + Intronic
1183736620 22:39648218-39648240 GGCTGGCACCCGAGGACGGGTGG - Intronic
1184035128 22:41914603-41914625 AGCGCGAGCCGGAGGCCGGGAGG + Exonic
1184842342 22:47059369-47059391 CGCTGGTGTGAGAGGCCGGGGGG - Intronic
1185275248 22:49947867-49947889 CACTGGCCCCGGAGGACAGGAGG - Intergenic
1185288755 22:50013876-50013898 TGCTGGCCCAGGAGGCAGGGAGG - Intergenic
1185317624 22:50185854-50185876 CGAGGGCGCCGGCGGCCGCGTGG - Intergenic
1185374143 22:50474557-50474579 GGCCGGGGCCGGGGGCCGGGCGG - Intronic
1185388561 22:50547415-50547437 TGCTTGCTCCGGGGGCCGGGTGG - Intergenic
1185409383 22:50674294-50674316 CGCCGGAGGCGGGGGCCGGGAGG - Intergenic
950386479 3:12664166-12664188 CGGTGGCGTCGCAGGTCGGGAGG - Exonic
952302984 3:32120928-32120950 AGCTGGGGCTGGAGGCGGGGAGG + Intronic
952319057 3:32259048-32259070 TGCAGGCGCCGGAGGGCAGGGGG + Intronic
952744534 3:36764545-36764567 TCCTGGCCCTGGAGGCCGGGCGG + Intergenic
953464356 3:43105910-43105932 CGCTGGGGGCGGCGGCGGGGTGG - Exonic
953618221 3:44510723-44510745 CGCTGGCGGCGGGCGGCGGGCGG + Intergenic
954004217 3:47578863-47578885 CGGCGGCGCGGGAGGCGGGGAGG - Exonic
954468872 3:50674952-50674974 CGGCGGCGCCGGGAGCCGGGCGG + Intergenic
955818796 3:62874852-62874874 CGCCGGCGCCGGAGCCGGGGTGG - Exonic
958407345 3:93765220-93765242 CACTGGAGCCCGAGGCAGGGAGG + Intergenic
959539458 3:107523393-107523415 GGCTGGGGCCGGGGGGCGGGGGG + Intronic
962808878 3:138945715-138945737 CGCGGGCGCCGGGGGCGCGGCGG + Exonic
967849451 3:194071078-194071100 GGGTGGCGCCCGGGGCCGGGTGG + Intergenic
967867738 3:194204165-194204187 CGCTGGAGCCGACGACCGGGCGG + Intergenic
967930680 3:194688053-194688075 CACTGGCGCCGTCGGCCTGGCGG - Exonic
968392902 4:207362-207384 CTCTGGGGCCAGAGGCAGGGAGG - Intergenic
968907905 4:3463127-3463149 CGCTTGCTCCAGAGGGCGGGCGG + Intergenic
969114092 4:4860442-4860464 CGCAGGCGCCGGAGGCCACCAGG - Intronic
972396518 4:38663730-38663752 CGCCGCCGCCCGAGCCCGGGGGG - Intergenic
976600709 4:86935280-86935302 CGGCGGCGTCGGGGGCCGGGCGG - Intronic
979666494 4:123316670-123316692 CTCTGGTGCAGGAGGCTGGGTGG + Exonic
981550610 4:145937754-145937776 CGCTGCCGCCGGCGGCTCGGGGG + Intronic
984966365 4:185143512-185143534 CGCGGGCGCGGCGGGCCGGGCGG + Intronic
984973536 4:185210293-185210315 AGCTGGCACCGGAAGCGGGGAGG - Intronic
985114437 4:186577014-186577036 GGCTGGCCCCGGAGGCTGTGTGG - Intergenic
985309855 4:188585840-188585862 GGCTGGCTCTGGAGGCCTGGAGG - Intergenic
985660863 5:1155926-1155948 GGCGGGCGCGGGAGGCCGGGAGG + Intergenic
985745689 5:1645548-1645570 GGCTGGATCCGGAGGCCTGGTGG - Intergenic
985783609 5:1883055-1883077 CGCCGGCGGCTCAGGCCGGGAGG + Intronic
988564717 5:32312316-32312338 CGCAGGCAGCGGAGGCCGGCGGG + Intronic
988796379 5:34656566-34656588 CGCTGGGGACGGCGCCCGGGCGG + Intronic
996091443 5:119355829-119355851 CGCTCGGGCCGGCAGCCGGGCGG - Intronic
997521280 5:134525891-134525913 GGCCGGCGCGGGAGGGCGGGGGG - Intronic
998538771 5:142959544-142959566 CGCTGCCTCCAGAGGCTGGGAGG - Intronic
999136134 5:149320629-149320651 CCCTGGCACAGGAGGCTGGGTGG + Intronic
999428120 5:151504895-151504917 CTCTGGGGCCCGAGGCCTGGTGG + Exonic
1002064878 5:176647136-176647158 TGATGGCGCCGGAGGCCGCCGGG - Intergenic
1002160718 5:177312517-177312539 CGCAGGCGCCGGCGGAGGGGCGG + Intronic
1006152940 6:31998946-31998968 GGCTGGCGCAGGGAGCCGGGTGG + Intronic
1006159248 6:32031683-32031705 GGCTGGCGCAGGGAGCCGGGTGG + Intronic
1012211282 6:96521724-96521746 CGCTTGCGCCCGAGGCGCGGGGG - Intronic
1013619378 6:111873144-111873166 CGCGGGCGGCGGCCGCCGGGCGG + Exonic
1014098248 6:117482810-117482832 CACTGGCGCGGGCTGCCGGGCGG + Exonic
1016596985 6:145814480-145814502 CGCTGGCGCTGGCGGCCGTGGGG - Intronic
1016936216 6:149451029-149451051 GGCTGGAGCTGCAGGCCGGGCGG + Exonic
1016982130 6:149863646-149863668 TGCGGGCGCCGGCGGCCGTGCGG - Exonic
1017158222 6:151341510-151341532 GGCTGGCGCCGGGCGCGGGGAGG + Intronic
1019411602 7:909125-909147 CGCTGGCGCCTGCTGTCGGGAGG - Intronic
1019411613 7:909159-909181 CGCTGGCGCCTGCTGTCGGGAGG - Intronic
1019411624 7:909193-909215 CGCTGGCGCCTGCTGTCGGGAGG - Intronic
1019411635 7:909227-909249 CGCTGGCGCCTGCTGTCGGGAGG - Intronic
1019411646 7:909261-909283 CGCTGGCGCCTGCTGTCGGGAGG - Intronic
1019411657 7:909295-909317 CGCTGGCGCCTGCTGTCGGGAGG - Intronic
1019411668 7:909329-909351 CGCTGGCGCCTGCTGTCGGGAGG - Intronic
1019411679 7:909363-909385 CGCTGGCGCCTGCTGTCGGGAGG - Intronic
1019411690 7:909397-909419 CGCTGGCGCCTGCTGTCGGGAGG - Intronic
1019626545 7:2018778-2018800 CACTGGTGGCAGAGGCCGGGCGG - Intronic
1019989564 7:4682274-4682296 CGCCGCCGCCGGAGGCCGCTCGG + Intergenic
1022419842 7:30210107-30210129 AGCTGCCGGAGGAGGCCGGGAGG + Intergenic
1026807100 7:73435471-73435493 CGCGGGGCCCGGAGGCCGGAGGG + Exonic
1026850319 7:73719556-73719578 CGCTGGCGGCGGGCGGCGGGCGG + Intronic
1026866625 7:73828072-73828094 GGCGGGGGCCGGGGGCCGGGGGG + Intronic
1026873067 7:73865066-73865088 GGCTGGCCCAGGAGGCCCGGGGG + Exonic
1026944539 7:74307243-74307265 CGCTGTCCCCAGAGGCCAGGGGG + Intronic
1027244783 7:76359394-76359416 CGCAGGCGCAGGAGGACGGGGGG + Intergenic
1029640405 7:101816403-101816425 CGCTGGCGGCGGCGGCGGCGCGG - Intronic
1029896662 7:103990245-103990267 CGCTGCCGCGAGGGGCCGGGCGG - Intergenic
1032001980 7:128271579-128271601 AGCTGGGCCGGGAGGCCGGGAGG + Intergenic
1032020706 7:128405964-128405986 CGCTGCTGCCGCGGGCCGGGCGG + Intronic
1032260436 7:130331766-130331788 CCCTGGCGCAGGAGGGAGGGAGG - Intergenic
1033339177 7:140478926-140478948 CGCTGTCCGCGGAGGCCTGGCGG - Intronic
1033361332 7:140640712-140640734 CGCTGGGGCCGGGGGCGGCGGGG - Exonic
1034554386 7:151840686-151840708 CTCTGGCGACGGAGGTCCGGGGG - Intronic
1035455424 7:159005933-159005955 CGCAGGCACCGGAGCGCGGGAGG - Intergenic
1036930590 8:12951888-12951910 CCCAGGCGCCGGACGCCGGGGGG + Intronic
1037337050 8:17801561-17801583 GGCTGGCGCCGGGGGGCGTGGGG - Intergenic
1039949043 8:42153403-42153425 CGGCGGCGACGGAGGCCGCGGGG - Intronic
1040471539 8:47738576-47738598 TCCTGTCGCCGGAGGGCGGGGGG + Exonic
1040850827 8:51899077-51899099 CGGCGGCTCCGGAGTCCGGGAGG - Exonic
1044692898 8:94896266-94896288 CGCTGGCGGCGGCGGCGGGGCGG - Intronic
1049289088 8:141792047-141792069 GGATGGCACCGGAGGCCAGGTGG - Intergenic
1049356901 8:142193460-142193482 GTCTGGAGCCGGAGGCCAGGTGG - Intergenic
1049721248 8:144116470-144116492 GGCAGGAGCCGGAGGCCTGGCGG + Exonic
1049798890 8:144508788-144508810 CCCTGGAGCCGGTGGCCGCGGGG + Intergenic
1052903825 9:33817299-33817321 CGCAGGGGCCGGAGGGCGCGCGG - Intergenic
1056153939 9:83817197-83817219 CGCGGGCGCCAGCGGCGGGGAGG + Intronic
1056532288 9:87498135-87498157 AGCTGGCGCCGGGGGTCGGGGGG - Intronic
1057294649 9:93828059-93828081 CGCTGGCGGCCCAGGGCGGGCGG + Intergenic
1058851022 9:109012806-109012828 CGCTGGGCGGGGAGGCCGGGAGG + Intronic
1061396467 9:130346463-130346485 CGGTGGGGCTGGAGGCAGGGGGG + Intronic
1061680956 9:132242172-132242194 GGCCGGCGTCCGAGGCCGGGCGG + Exonic
1061727821 9:132590790-132590812 GCCTGGTGCGGGAGGCCGGGAGG - Intergenic
1062043302 9:134414009-134414031 CGCTGGCGCCGGAGGCCGGGCGG - Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062461968 9:136665964-136665986 CGCTGGGGCCGGGGGCGGAGCGG + Intronic
1062491673 9:136807974-136807996 CGGTCGCGCCGGAGGCCGCGGGG + Exonic
1062504603 9:136866508-136866530 CGCTGGGGCTGCAGGTCGGGAGG + Intronic
1062567528 9:137169952-137169974 CGCGGGTGCCGGGGGCGGGGGGG - Exonic
1203736852 Un_GL000216v2:144960-144982 TGCTGGCGACGGTGGCGGGGAGG - Intergenic
1187225850 X:17375147-17375169 CCCGGGCGCAGGAGGCCGCGCGG - Intergenic
1189332558 X:40152667-40152689 CGCTGGCTCCGGGGCCCGGGTGG - Intronic
1191830257 X:65407750-65407772 CCCGGGCGACTGAGGCCGGGGGG + Intronic
1192177443 X:68894769-68894791 TGCTGGCGCAGGCTGCCGGGAGG + Intergenic
1192350301 X:70350399-70350421 CACGGGAGCCGGAGGCAGGGAGG + Intronic
1192886070 X:75336220-75336242 CACTGGAGCCCGAGGCAGGGAGG + Intergenic
1196645893 X:118116920-118116942 CGCCTGCGCGGGAGGCAGGGTGG + Intronic