ID: 1062043516

View in Genome Browser
Species Human (GRCh38)
Location 9:134414936-134414958
Sequence GGCTCATGGAAGTCCCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062043506_1062043516 2 Left 1062043506 9:134414911-134414933 CCCGGATGAGCACCGCCCTCTGG 0: 1
1: 0
2: 0
3: 59
4: 373
Right 1062043516 9:134414936-134414958 GGCTCATGGAAGTCCCATGTGGG No data
1062043512_1062043516 -10 Left 1062043512 9:134414923-134414945 CCGCCCTCTGGAGGGCTCATGGA 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1062043516 9:134414936-134414958 GGCTCATGGAAGTCCCATGTGGG No data
1062043505_1062043516 3 Left 1062043505 9:134414910-134414932 CCCCGGATGAGCACCGCCCTCTG 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1062043516 9:134414936-134414958 GGCTCATGGAAGTCCCATGTGGG No data
1062043503_1062043516 7 Left 1062043503 9:134414906-134414928 CCCGCCCCGGATGAGCACCGCCC 0: 1
1: 0
2: 0
3: 17
4: 141
Right 1062043516 9:134414936-134414958 GGCTCATGGAAGTCCCATGTGGG No data
1062043504_1062043516 6 Left 1062043504 9:134414907-134414929 CCGCCCCGGATGAGCACCGCCCT 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1062043516 9:134414936-134414958 GGCTCATGGAAGTCCCATGTGGG No data
1062043502_1062043516 8 Left 1062043502 9:134414905-134414927 CCCCGCCCCGGATGAGCACCGCC 0: 1
1: 0
2: 1
3: 18
4: 93
Right 1062043516 9:134414936-134414958 GGCTCATGGAAGTCCCATGTGGG No data
1062043508_1062043516 1 Left 1062043508 9:134414912-134414934 CCGGATGAGCACCGCCCTCTGGA 0: 1
1: 0
2: 0
3: 38
4: 290
Right 1062043516 9:134414936-134414958 GGCTCATGGAAGTCCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062043516 Original CRISPR GGCTCATGGAAGTCCCATGT GGG Intronic
No off target data available for this crispr