ID: 1062044769

View in Genome Browser
Species Human (GRCh38)
Location 9:134419914-134419936
Sequence AGTGTGCACAGCCGGCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062044769_1062044776 23 Left 1062044769 9:134419914-134419936 CCCTGTGGCCGGCTGTGCACACT 0: 1
1: 0
2: 0
3: 4
4: 123
Right 1062044776 9:134419960-134419982 CCGTGTGCCCACTCCTGCAGAGG No data
1062044769_1062044773 -4 Left 1062044769 9:134419914-134419936 CCCTGTGGCCGGCTGTGCACACT 0: 1
1: 0
2: 0
3: 4
4: 123
Right 1062044773 9:134419933-134419955 CACTGCAGGCACATGACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062044769 Original CRISPR AGTGTGCACAGCCGGCCACA GGG (reversed) Intronic
900421279 1:2557006-2557028 AGTGCCCACATCCGGCCAAATGG - Intronic
900900065 1:5510040-5510062 AGTGTGCAGAACTGGCCACCAGG + Intergenic
900919690 1:5662452-5662474 AGTGGGCAGGGCTGGCCACACGG + Intergenic
903577391 1:24347319-24347341 AATCTGCAGAGCCGGCCAAAGGG + Intronic
903648055 1:24906458-24906480 TGTGTGCACAGCCGGCCCTTGGG - Intronic
904028307 1:27518729-27518751 AGTGTGCACAGCATCCCAGAAGG - Intergenic
904458081 1:30659087-30659109 AGGGGGCACAGCCGTCCCCAGGG + Intergenic
907466587 1:54641822-54641844 AGTCTCCACAGCCTCCCACAAGG + Exonic
909172568 1:72315154-72315176 AGTCTGCACTGATGGCCACATGG - Intergenic
910650350 1:89559711-89559733 AGTGTCCATAGCAAGCCACATGG + Intronic
913253031 1:116928073-116928095 AGTGTGACCAACAGGCCACAGGG - Intronic
1063002702 10:1939688-1939710 AGTGTTCACTGCTGGCCAAAAGG - Intergenic
1063120287 10:3101117-3101139 AGGGTGCAGAGCCAGACACACGG - Intronic
1063317608 10:5021514-5021536 ACTGCACACAGCCGGACACAGGG + Intronic
1067400109 10:45964964-45964986 TGTGTGCTCAGCTGACCACAGGG - Intergenic
1067512154 10:46905033-46905055 AGCAGGCACAGCAGGCCACATGG - Intergenic
1067667911 10:48294239-48294261 AGTGTGCAATGCCTCCCACAGGG - Intergenic
1067715070 10:48684709-48684731 AGGCTGCACAGCCAGCCCCAAGG + Intergenic
1067868440 10:49934256-49934278 TGTGTGCTCAGCTGACCACAGGG - Intronic
1071531101 10:86390870-86390892 ACTGGGCACACACGGCCACAGGG - Intergenic
1076457121 10:130608238-130608260 AGTGAGCTCAGCTGACCACAGGG + Intergenic
1076492761 10:130874351-130874373 AGTGTGGACAGCAGGTTACAGGG - Intergenic
1077213548 11:1384410-1384432 CGGGTGCCCTGCCGGCCACAAGG - Intergenic
1077370528 11:2179699-2179721 TGTGTGGACAGCCGGCCAAGAGG - Intergenic
1078364517 11:10694997-10695019 AGTGTCCACACCTGTCCACATGG + Intergenic
1080583235 11:33660236-33660258 ACTGTGCACAGCTGGGCAGATGG - Intronic
1081759580 11:45567902-45567924 AGTGTGCAAAGCAGGTCGCAAGG - Intergenic
1083490379 11:63011106-63011128 AGGGTGCACAGTCAGCCTCACGG + Intronic
1083734616 11:64672270-64672292 ATCCTGCACAGCCTGCCACAGGG - Intronic
1083844306 11:65321913-65321935 ACAGGGCACAGCTGGCCACAGGG + Exonic
1088693328 11:112345998-112346020 AGTCTCCACAGCAGGCCAGAGGG + Intergenic
1089849371 11:121482992-121483014 ATTGTGCAGTGCTGGCCACATGG + Intronic
1090664145 11:128903845-128903867 CTTGTGCACAGCGGACCACATGG + Intronic
1091982502 12:4877678-4877700 ATTGGGCACACCAGGCCACAAGG - Intergenic
1094699690 12:32856865-32856887 ATGGTGCACTGCCTGCCACAAGG - Intronic
1104965308 12:132506343-132506365 AGTGCTCACAGCTGGCCAGAAGG - Intronic
1106015289 13:25863389-25863411 AGTGTGCACACTGGGCCAAAGGG + Intronic
1108846092 13:54679613-54679635 AGGGTGCATGGCCGGCCAAAAGG - Intergenic
1110676157 13:78247811-78247833 TGTGTACACATCTGGCCACATGG - Intergenic
1118590039 14:67394422-67394444 AGAGTGCACAGTAGCCCACATGG + Intronic
1122205184 14:100144813-100144835 AGTGTGCCCAGCAGCCCCCAAGG + Exonic
1122925444 14:104897466-104897488 ACTGTCCACTTCCGGCCACAGGG + Intergenic
1127502718 15:59569693-59569715 AGTATACACAGCAGGCAACAGGG - Intergenic
1128451532 15:67808549-67808571 AATGGGCACAGGCGGCCCCAGGG - Intergenic
1128723954 15:69974222-69974244 AGCGTGTAAAGCTGGCCACATGG - Intergenic
1129446984 15:75625575-75625597 AGAGTGCAGGGCCGGCCAGAGGG + Exonic
1132932241 16:2464586-2464608 GCTGTGCACAGCCCGGCACAGGG - Exonic
1134059434 16:11190228-11190250 AGGGTGCACAGCTAGCCACAGGG - Intergenic
1134718283 16:16367695-16367717 CGTGTGGAAGGCCGGCCACAAGG + Intergenic
1135953819 16:26939105-26939127 AGTTTGTACAGCTGCCCACAGGG - Intergenic
1139083860 16:63560895-63560917 AGCCTGCAAAGCCAGCCACAGGG - Intergenic
1142095679 16:88238191-88238213 AGTGGGTGCTGCCGGCCACATGG - Intergenic
1142284737 16:89167156-89167178 AGTGGGCGGAGCTGGCCACAGGG - Intergenic
1142302577 16:89267084-89267106 GGCGTGCACAGCTGGCCACGGGG + Intergenic
1151729011 17:75900045-75900067 TGTGTGCCCAGCCTGGCACAGGG + Intronic
1155356521 18:24958876-24958898 AGTGTGCACAGCGGGCCCTGAGG + Intergenic
1156362064 18:36391983-36392005 GGTGAGCACAGCATGCCACAGGG - Intronic
1156380996 18:36561027-36561049 AATGTGTACAGCCCTCCACAGGG - Intronic
1157293279 18:46424990-46425012 AGACAGGACAGCCGGCCACAGGG - Intronic
1160368438 18:78349823-78349845 AGGGAGCACAGCTGGCCTCAGGG + Intergenic
1164426629 19:28147569-28147591 AGCCAGCACAGCCGGGCACAGGG + Intergenic
1164756741 19:30695357-30695379 TGTGTGCAGAGCCCGCCAGAGGG + Intronic
1166072384 19:40394799-40394821 AGAGGGCACAGCAGGCTACAGGG - Exonic
925154580 2:1639653-1639675 AGTGTGCCCAGCTGTCCTCAGGG - Intronic
936350237 2:111706934-111706956 AGGGAGCCCAGCCGGGCACAGGG - Intergenic
936746450 2:115582187-115582209 CGTGCGGACAGCCTGCCACAAGG - Intronic
938178900 2:129162298-129162320 GGTGTGCAGAGCTGGCCTCAAGG + Intergenic
938307420 2:130265223-130265245 ACAGTGCACGGCCGGGCACATGG - Intergenic
938447913 2:131391619-131391641 ACAGTGCACGGCCGGGCACATGG + Intergenic
938712585 2:133988593-133988615 CATGTGCACAGCCTGCCTCAAGG - Intergenic
946166832 2:217869579-217869601 AGTCTCCCCAGGCGGCCACATGG + Intronic
948728808 2:239950753-239950775 GGTCTGCACAGCCGACCACGGGG - Intronic
1170539939 20:17377428-17377450 AGTGTGCACATTGGGCCCCAGGG + Intronic
1171472217 20:25381226-25381248 ACTGTGCACACACAGCCACAGGG + Intronic
1175359922 20:58401573-58401595 AGTGGGCAAAACTGGCCACATGG - Intronic
1175920421 20:62448158-62448180 ATTGGGCACAGACGGGCACAGGG - Intergenic
1177516399 21:22157097-22157119 AATGTACAAAGCCTGCCACAAGG + Intergenic
1180600173 22:17010245-17010267 AGAGTGCAGAGACTGCCACAGGG + Intergenic
1181945307 22:26512372-26512394 GGTGAGCACGGCTGGCCACAAGG - Exonic
1184749038 22:46473624-46473646 TGTGATCACAGCCGGCCACGGGG - Intronic
953792153 3:45955915-45955937 GGTTTGCACAGTCGGACACAAGG - Intronic
953819104 3:46188941-46188963 AGTGTGCACAAGCCACCACAGGG - Intronic
956951525 3:74288980-74289002 TGTGTGCTCAGCATGCCACATGG + Intronic
958170454 3:89933272-89933294 ACTGTCCACAGCCTGACACATGG + Intergenic
966200041 3:177352681-177352703 ACTGCCCACAGCCAGCCACATGG + Intergenic
968964015 4:3760398-3760420 AGTGTGCACAGCGGCCACCAAGG + Intergenic
969675001 4:8609809-8609831 AGAGATCACTGCCGGCCACAGGG - Intronic
971930812 4:33080413-33080435 AGGCTTCACAGCTGGCCACATGG - Intergenic
972676848 4:41268238-41268260 AGAGTGCACAGCTGTCCACTGGG + Exonic
975222866 4:71833394-71833416 CATGTGGACAGCCTGCCACAAGG - Intergenic
975422542 4:74184858-74184880 ACTGTGCACAGCCTTCCAGAAGG - Intronic
979038730 4:115759469-115759491 CATGTGGACAGCCCGCCACAAGG + Intergenic
987386930 5:17338800-17338822 TGTGGGCACAGCTGGACACAAGG + Intergenic
989439815 5:41457188-41457210 AGTGTGGACACCAGGCGACATGG - Intronic
992221593 5:74579258-74579280 AGTGTGCACCGCCGGCTTCCGGG + Intergenic
998680442 5:144460764-144460786 TGTTTACACAGCTGGCCACAGGG - Intronic
999341477 5:150777405-150777427 AATGTTCACAGCAGGGCACATGG + Intergenic
1001733146 5:173974783-173974805 CCTGTGCACAACCGGCCTCAAGG - Intronic
1003382377 6:5636920-5636942 AGTGAGCACAGCGTGCCCCAGGG + Intronic
1004070848 6:12296111-12296133 AGAGTGCAGAGTCGGCCACAGGG - Exonic
1004223271 6:13765078-13765100 ACTGTGCCCAGCCTGCTACAAGG + Intergenic
1007116676 6:39348015-39348037 AGCGTGCAGAGCCTGCCACCTGG - Intronic
1011651329 6:89509074-89509096 AGGGTGCACAGTCGCCCAGAGGG - Intronic
1013048779 6:106512197-106512219 AGACTGCACAGCCCGCCCCAAGG + Exonic
1018882335 6:167897026-167897048 ATTGTACAGAGCCTGCCACATGG + Intronic
1025232385 7:57211326-57211348 AGGGTGCACACCCAGCCTCAGGG - Intergenic
1027725160 7:81795660-81795682 AGTGTGCATAGCCAGTCACTGGG + Intergenic
1028756216 7:94437325-94437347 AATTTTTACAGCCGGCCACACGG - Intergenic
1035158780 7:156935639-156935661 GGCGTGCACAGCCGGAGACAGGG + Intergenic
1038350876 8:26775085-26775107 AGTGAGCAAAGCCGGCCGGATGG - Intronic
1038938892 8:32282144-32282166 AGTTTGCACAGCTGGACACAGGG + Intronic
1040664894 8:49620463-49620485 AGTGGTCACAGCCGGCTCCAGGG + Intergenic
1041023315 8:53659204-53659226 AGTGAGCACAGATGACCACAGGG - Intergenic
1041797784 8:61763765-61763787 AGTGTGGACAGCAGGAAACAGGG - Intergenic
1048221193 8:132543668-132543690 AGTGTGACCAGGTGGCCACATGG - Intergenic
1048878421 8:138854547-138854569 AGTGTGCTGAGCAGGCCAAAGGG - Intronic
1049247505 8:141570612-141570634 AGGGTGCACAGGAGGGCACAGGG + Intergenic
1050204933 9:3186439-3186461 CGTGTGCACAGCCCACCCCAAGG + Intergenic
1051179560 9:14395994-14396016 ACAGTGCACTGCCGGCAACAGGG - Intronic
1057448258 9:95134345-95134367 AGTGGGCACAGCCAACCTCAGGG + Intronic
1062044769 9:134419914-134419936 AGTGTGCACAGCCGGCCACAGGG - Intronic
1062076022 9:134590407-134590429 GGTGAGCACAGCCAGGCACATGG + Intergenic
1062218646 9:135402791-135402813 AGAGAGCACAGCCGGCTCCAGGG - Intergenic
1062357009 9:136169858-136169880 AGTGTGCACAGCCAGGCAGAGGG + Intergenic
1062626638 9:137445997-137446019 TGGGTGCACATCCGGCCACGGGG + Intergenic
1203731944 Un_GL000216v2:99014-99036 AGTGTCCTCAGCCGGTGACATGG + Intergenic
1190337765 X:49272767-49272789 AGCATGCACAGCAGGCCTCACGG - Intronic
1197922766 X:131612871-131612893 AATGGGCACAGAGGGCCACAAGG + Intergenic