ID: 1062044770

View in Genome Browser
Species Human (GRCh38)
Location 9:134419915-134419937
Sequence CAGTGTGCACAGCCGGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062044770_1062044776 22 Left 1062044770 9:134419915-134419937 CCTGTGGCCGGCTGTGCACACTG 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1062044776 9:134419960-134419982 CCGTGTGCCCACTCCTGCAGAGG No data
1062044770_1062044773 -5 Left 1062044770 9:134419915-134419937 CCTGTGGCCGGCTGTGCACACTG 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1062044773 9:134419933-134419955 CACTGCAGGCACATGACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062044770 Original CRISPR CAGTGTGCACAGCCGGCCAC AGG (reversed) Intronic
900364305 1:2304626-2304648 CAGTGAGCACAGCCTGCACCAGG + Intronic
900625543 1:3606965-3606987 CAGGCTGCACAGCAGGCCCCAGG - Intronic
901225111 1:7608821-7608843 CAGGGGCCTCAGCCGGCCACAGG + Intronic
901688053 1:10955279-10955301 AAGTGTGCTGTGCCGGCCACAGG - Intronic
902451785 1:16500962-16500984 CAGTATGCACAGCCAGTCCCTGG + Intergenic
902501163 1:16912703-16912725 CAGTATGCACAGCCAGTCCCTGG - Intronic
903648056 1:24906459-24906481 CTGTGTGCACAGCCGGCCCTTGG - Intronic
904334191 1:29786393-29786415 CAGTGTGCCCAGCCTGGCAGTGG + Intergenic
905396108 1:37667679-37667701 GAGTGTGCACAGAGGACCACTGG - Intergenic
907029181 1:51153725-51153747 CAGTGTCCACAGCCAGACAGAGG - Intergenic
910194367 1:84624949-84624971 CAGTTTGGACACCCAGCCACCGG + Intergenic
910505262 1:87943264-87943286 CAGTGTGCACAGGCTGCAAAAGG + Intergenic
913129675 1:115828403-115828425 CCGTGTCCACAGGCGCCCACTGG + Intergenic
913253032 1:116928074-116928096 CAGTGTGACCAACAGGCCACAGG - Intronic
917441460 1:175072536-175072558 CAGTATGCACAGCAAACCACAGG - Intronic
920500647 1:206482962-206482984 CAGTGTGCATATCCTGCCTCAGG + Intronic
1067400110 10:45964965-45964987 CTGTGTGCTCAGCTGACCACAGG - Intergenic
1067667912 10:48294240-48294262 CAGTGTGCAATGCCTCCCACAGG - Intergenic
1067868441 10:49934257-49934279 CTGTGTGCTCAGCTGACCACAGG - Intronic
1068121767 10:52788039-52788061 CAGTGTGCAAAGCCTACAACGGG - Intergenic
1069575857 10:69528147-69528169 CACTGTGCACAGTTGGACACTGG + Intergenic
1070731609 10:78832294-78832316 CAGTGTGCACACCAGGTTACAGG + Intergenic
1075209147 10:120476196-120476218 CAGGGGGCACAGCTGGCCCCAGG - Intronic
1076457120 10:130608237-130608259 CAGTGAGCTCAGCTGACCACAGG + Intergenic
1076492762 10:130874352-130874374 CAGTGTGGACAGCAGGTTACAGG - Intergenic
1076700840 10:132271827-132271849 CAGTGTGCCCAGGAGGCCGCAGG - Intronic
1076781227 10:132725684-132725706 AGGTGTGCACAGCTGTCCACAGG - Intronic
1077104848 11:837737-837759 CACTGCCCACATCCGGCCACTGG - Intronic
1077994145 11:7438750-7438772 CAATGTGCACAGCAGAGCACTGG - Intronic
1078527818 11:12113485-12113507 CAGAGTGCAGAGACAGCCACAGG - Intronic
1084938269 11:72598909-72598931 CAATGTGGACAGCCGGGAACTGG - Intronic
1085273022 11:75281472-75281494 CTGTGTGCACACCCGGCCCTGGG + Intronic
1088693327 11:112345997-112346019 CAGTCTCCACAGCAGGCCAGAGG + Intergenic
1091802615 12:3334136-3334158 CTGTGTGCACTGCCACCCACAGG + Intergenic
1102046344 12:109832536-109832558 CTGTGTGCAGAGCTGGCCCCAGG + Intronic
1102472734 12:113168640-113168662 CACTGTGCCCAGCCGCCCACAGG - Intronic
1103781966 12:123404814-123404836 CACTGTGCACAGCAGGTCTCCGG - Intronic
1103845832 12:123901451-123901473 CAGCGTGCAAAGCCGTGCACGGG - Intronic
1104716387 12:131019027-131019049 AAGTGTGCACACCCGGGCACAGG - Intronic
1104831205 12:131753079-131753101 GAGTGAGCATGGCCGGCCACAGG - Intronic
1104965773 12:132508251-132508273 CAGTGAGAACAGGCGGCCCCTGG + Exonic
1106015288 13:25863388-25863410 CAGTGTGCACACTGGGCCAAAGG + Intronic
1107943098 13:45392140-45392162 CAGTGAGAACCGCCGGCCGCTGG - Intergenic
1119603240 14:75991864-75991886 CAGTGTGGGCAGCCTCCCACGGG + Intronic
1121422157 14:93823808-93823830 CTTTATGCACAGCAGGCCACTGG + Intergenic
1122329863 14:100904801-100904823 CACTTTGGAAAGCCGGCCACCGG - Intergenic
1122398566 14:101452684-101452706 CACTGTGTCCCGCCGGCCACAGG + Intergenic
1122925443 14:104897465-104897487 CACTGTCCACTTCCGGCCACAGG + Intergenic
1123699435 15:22903530-22903552 CTGTGTGCACAGGCAGCCTCGGG - Intronic
1124042978 15:26121874-26121896 CAGCGCCCACAGCCGGACACTGG - Intergenic
1124638590 15:31380883-31380905 CACTGTGCCCAGCCAGCAACTGG - Intronic
1127414992 15:58749363-58749385 CAGTCAGCCCAGCCGGCCAGCGG - Intronic
1128451533 15:67808550-67808572 CAATGGGCACAGGCGGCCCCAGG - Intergenic
1129446983 15:75625574-75625596 CAGAGTGCAGGGCCGGCCAGAGG + Exonic
1130056137 15:80527717-80527739 CAGTTTGCACAGCTGGTAACTGG + Intronic
1132314017 15:100878150-100878172 CAGTGTGTGCAGCAGGCCCCAGG - Intronic
1134059435 16:11190229-11190251 GAGGGTGCACAGCTAGCCACAGG - Intergenic
1134265138 16:12686042-12686064 CTGTGTGGACAGAGGGCCACGGG - Intronic
1140235434 16:73154398-73154420 GACTGGGCACAGGCGGCCACTGG + Intergenic
1140964938 16:79956616-79956638 CAGTCTGCATAGCTGGCCTCAGG + Intergenic
1141368734 16:83467832-83467854 CAGTGTGCACATCGGACCCCAGG - Intronic
1142302576 16:89267083-89267105 GGGCGTGCACAGCTGGCCACGGG + Intergenic
1143123689 17:4626762-4626784 TAGTGGGGACAGCAGGCCACAGG + Intergenic
1143651022 17:8264414-8264436 CTGTGTGCCCAGCCCGCCCCAGG + Intronic
1144769961 17:17754108-17754130 CAGGCTGCACAGCTGGCCAGTGG - Intronic
1144968084 17:19090221-19090243 CAGAGGGGACAGCCAGCCACTGG + Intergenic
1144979833 17:19161842-19161864 CAGAGGGGACAGCCAGCCACTGG - Intergenic
1144988389 17:19216390-19216412 CAGAGGGGACAGCCAGCCACTGG + Intronic
1148228829 17:45918521-45918543 CAGAGCGCACAGCCAGCAACTGG + Intronic
1148790458 17:50169785-50169807 CAGGGTCCACAGCCAGCGACTGG + Intronic
1151290268 17:73144767-73144789 CAGATTGCACAGACGGCCTCGGG - Intergenic
1151658610 17:75507301-75507323 CAGTGGGCACAGCAGGACTCTGG - Intronic
1152703982 17:81833429-81833451 CGGTGAGCGCCGCCGGCCACTGG + Intergenic
1153797339 18:8636250-8636272 CAGTTTGCACAGCAGATCACTGG + Exonic
1156362065 18:36391984-36392006 CGGTGAGCACAGCATGCCACAGG - Intronic
1159735230 18:72088684-72088706 CAGTGTGCACAGCAAGCGCCAGG - Intergenic
1160014413 18:75129353-75129375 CATTGTGCTCAGGTGGCCACAGG - Intergenic
1160835715 19:1123612-1123634 GAGTGTGCAGAGCCAGCCAGAGG - Exonic
1162267734 19:9589661-9589683 TAGTGCGCACAGCAGGCCAGAGG - Intergenic
1163081936 19:14950372-14950394 CATTGTGCGAAGCCGGTCACTGG + Exonic
1164445298 19:28312470-28312492 CAGGGTGCACAGCCCTCCCCTGG - Intergenic
1164756740 19:30695356-30695378 CTGTGTGCAGAGCCCGCCAGAGG + Intronic
1166072385 19:40394800-40394822 CAGAGGGCACAGCAGGCTACAGG - Exonic
1167805466 19:51780686-51780708 CAGTGTGTTCAACCTGCCACTGG - Intronic
925154581 2:1639654-1639676 CAGTGTGCCCAGCTGTCCTCAGG - Intronic
925340762 2:3134044-3134066 CAGGGTGTCCAGCTGGCCACTGG - Intergenic
926668074 2:15546887-15546909 CAGAGTGCCCACCCAGCCACTGG + Intronic
927859668 2:26552807-26552829 CTGTGTCCACAGCCAGCCACCGG + Intronic
928149158 2:28810754-28810776 CAGCGCGCACAGCCGGCCGAGGG - Intronic
935632945 2:105227045-105227067 CAGTTTGCACAGTCAGTCACTGG + Intergenic
935714053 2:105924476-105924498 CAGCCTGCAGAGCCTGCCACAGG + Intergenic
935939218 2:108221080-108221102 CACTGGGCACAGCAGGACACGGG + Intergenic
944696209 2:202202485-202202507 CTGTGTCCACTGCAGGCCACTGG - Intergenic
945411003 2:209506853-209506875 CAGTCTGCACAGACTGACACAGG - Intronic
945881181 2:215326934-215326956 CAGTGTGTACAGCTGGGCAGGGG - Exonic
948079976 2:235198090-235198112 CACTGAGCACAGCCGGGCACTGG - Intergenic
948728809 2:239950754-239950776 GGGTCTGCACAGCCGACCACGGG - Intronic
1169198594 20:3696796-3696818 CACTGTGGACAGCCGCCCCCTGG - Exonic
1169224557 20:3847848-3847870 CAAGGTGCACAGCTGGCCAGAGG - Intronic
1170898418 20:20437046-20437068 CATTGTGCAGAGGAGGCCACAGG - Intronic
1174405891 20:50303155-50303177 CACTGTGCCCAGCCGTGCACGGG - Intergenic
1176177982 20:63737626-63737648 CGCTGTGCACAGCCTGCCGCAGG + Exonic
1176192009 20:63815990-63816012 CAGTGGGCACAGGTGGGCACAGG + Intronic
1176192029 20:63816070-63816092 CAGTGGGCACAGGTGGGCACAGG + Intronic
1176238284 20:64064253-64064275 CAGTGAACAGAGCCGGCCAGAGG - Intronic
1178725430 21:35047077-35047099 CAGTGTGCAGTGCTGGCCCCTGG - Intronic
1179647010 21:42782219-42782241 CAGTGTCCACAGACGGCCTGAGG - Intergenic
1181496018 22:23287963-23287985 CCGTGAGCACACCTGGCCACTGG + Intronic
1181670310 22:24422802-24422824 CATTGGGCACAGCTGGACACTGG + Intronic
1183098236 22:35567406-35567428 CAGTGTGCAGACCTGGCCATGGG - Intergenic
1183482107 22:38070787-38070809 CAGTGGGCTCAGCAAGCCACAGG - Intronic
1183521949 22:38300680-38300702 CAGTGTGCACCCGGGGCCACTGG - Intronic
1184058039 22:42065754-42065776 CAGTGCCCAGGGCCGGCCACTGG + Exonic
1184477048 22:44727612-44727634 CAGGGTGCCAAGCAGGCCACCGG + Intronic
1184749039 22:46473625-46473647 ATGTGATCACAGCCGGCCACGGG - Intronic
1184956191 22:47888061-47888083 CAGTGTTCACAGCCAGCTGCAGG - Intergenic
953531692 3:43745494-43745516 CAGTGGGCACAGCAGGCGGCAGG + Intergenic
953819105 3:46188942-46188964 CAGTGTGCACAAGCCACCACAGG - Intronic
953864085 3:46568887-46568909 CACTGTGCCCAGCCTGCTACTGG - Intronic
954839195 3:53495794-53495816 ACGTGTGCACAGCCGGCGACGGG - Intronic
961320424 3:126069295-126069317 CAGTGTGCACACAGAGCCACTGG + Intronic
962388338 3:134951350-134951372 CACTGTACATAGCAGGCCACAGG - Exonic
969675002 4:8609810-8609832 CAGAGATCACTGCCGGCCACAGG - Intronic
972676847 4:41268237-41268259 CAGAGTGCACAGCTGTCCACTGG + Exonic
976573951 4:86646584-86646606 CACTGTGCCCAGCCAGCAACTGG + Intronic
978432277 4:108645215-108645237 CTGAGTGCCCAGCCTGCCACAGG - Intergenic
985353829 4:189096278-189096300 CCGCGTGCCCAGCCGGCCAGTGG - Intergenic
985555371 5:555460-555482 CAGTGGGCACATCAGGCCCCTGG + Intergenic
985795983 5:1962476-1962498 GTGTGCGCCCAGCCGGCCACAGG + Intergenic
988542865 5:32128035-32128057 CAGTGTGCAAAGCAGACTACTGG + Intronic
992221592 5:74579257-74579279 CAGTGTGCACCGCCGGCTTCCGG + Intergenic
992584025 5:78214043-78214065 CAGTGTGCACATCAGCCCTCAGG - Intronic
993536714 5:89095625-89095647 CAGTGTTCACTTCAGGCCACAGG - Intergenic
994262223 5:97673282-97673304 CAGTGAGAACAGCCTACCACAGG + Intergenic
999459206 5:151743142-151743164 CAGTGTGCAGGGCTGGACACTGG - Intronic
1001620586 5:173081632-173081654 CACTGTGCCTAGCCGGCCGCTGG - Intronic
1004070849 6:12296112-12296134 GAGAGTGCAGAGTCGGCCACAGG - Exonic
1009505040 6:64467709-64467731 CAGTGTGCAGAGCAGGCCTATGG - Intronic
1017719413 6:157234550-157234572 CCACGTGCCCAGCCGGCCACTGG + Intergenic
1020655814 7:10927049-10927071 TTGTGTGCACAGCAGGCCAGAGG + Intergenic
1023817853 7:43963976-43963998 AAGTATTCACAGCCGGGCACAGG + Intergenic
1025232386 7:57211327-57211349 CAGGGTGCACACCCAGCCTCAGG - Intergenic
1026777084 7:73237181-73237203 CACTGTGCCCAGCCGTCCAGTGG - Intergenic
1027017930 7:74790551-74790573 CACTGTGCCCAGCCGTCCAGTGG - Intergenic
1027070093 7:75155378-75155400 CACTGTGCCCAGCCGTCCAGTGG + Intergenic
1027175718 7:75902000-75902022 CAGTGAGCCCAGCTGGCCAGAGG - Intronic
1027725159 7:81795659-81795681 CAGTGTGCATAGCCAGTCACTGG + Intergenic
1028793777 7:94881690-94881712 TTGTGTGCACAGCAGGCCAGAGG + Intergenic
1029645204 7:101850666-101850688 CATTGTGCCCAGCCAGCCCCTGG + Intronic
1030662031 7:112230136-112230158 CACTGCGCCCAGCCAGCCACAGG - Intronic
1034490938 7:151392698-151392720 CAGGGTGCACAGCCTGTGACAGG - Intronic
1035789057 8:2287099-2287121 CACTGTGCCCAGCCAGACACAGG + Intergenic
1035803748 8:2434606-2434628 CACTGTGCCCAGCCAGACACAGG - Intergenic
1036148260 8:6274881-6274903 CTGTGAGCCCAGCCGGCTACTGG + Intergenic
1037796972 8:22003926-22003948 TATTGTGAACAGCCAGCCACCGG + Exonic
1037907854 8:22725898-22725920 CACTGTGCACTTCCGGCCACTGG + Intronic
1038521293 8:28234330-28234352 CAGTGTGCACAACAGGACACAGG + Intergenic
1038938891 8:32282143-32282165 GAGTTTGCACAGCTGGACACAGG + Intronic
1044862161 8:96534070-96534092 CAGTGGGCACCGCCGGCCCCGGG - Intronic
1048878422 8:138854548-138854570 CAGTGTGCTGAGCAGGCCAAAGG - Intronic
1048986544 8:139737952-139737974 CAGTGTTCACAGCCAGCCCGCGG - Intronic
1049247504 8:141570611-141570633 CAGGGTGCACAGGAGGGCACAGG + Intergenic
1051179561 9:14395995-14396017 CACAGTGCACTGCCGGCAACAGG - Intronic
1058034836 9:100239682-100239704 CACTGTGCCCAGCCTGGCACAGG - Intronic
1059887384 9:118761536-118761558 CAGTAGCCACAGCCAGCCACTGG + Intergenic
1061133027 9:128718761-128718783 CAGTGTGCCCAGCTGTCCCCTGG - Intronic
1061274536 9:129561872-129561894 CAGGATCCACAGCCGGCCACTGG + Intergenic
1061807331 9:133143858-133143880 CGGAGTGCACAGCGGGCCGCTGG - Intronic
1062044770 9:134419915-134419937 CAGTGTGCACAGCCGGCCACAGG - Intronic
1062218647 9:135402792-135402814 CAGAGAGCACAGCCGGCTCCAGG - Intergenic
1062357008 9:136169857-136169879 CAGTGTGCACAGCCAGGCAGAGG + Intergenic
1062626637 9:137445996-137446018 CTGGGTGCACATCCGGCCACGGG + Intergenic
1187367190 X:18675259-18675281 CAGGGTGCACTTCCGGCCGCCGG - Intergenic
1189074968 X:37905629-37905651 CAGGATGCACAGCCAGCCCCAGG - Intronic
1190308855 X:49102317-49102339 CAGAGTGCACAGCCTGACCCTGG - Intergenic
1191105628 X:56770423-56770445 CAGGGTGCAGAGCCGCCTACTGG + Intergenic
1191106621 X:56775825-56775847 CAGGGTGCAGAGCCGCCTACTGG + Intergenic
1200162415 X:154016348-154016370 CAGAGTGCACTGCGGGCCAGGGG - Intronic
1201063816 Y:10070350-10070372 CAGTGGGCACAGCCTGGCCCTGG + Intergenic