ID: 1062044772

View in Genome Browser
Species Human (GRCh38)
Location 9:134419922-134419944
Sequence GTGCCTGCAGTGTGCACAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062044772_1062044776 15 Left 1062044772 9:134419922-134419944 CCGGCTGTGCACACTGCAGGCAC No data
Right 1062044776 9:134419960-134419982 CCGTGTGCCCACTCCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062044772 Original CRISPR GTGCCTGCAGTGTGCACAGC CGG (reversed) Intronic