ID: 1062044772

View in Genome Browser
Species Human (GRCh38)
Location 9:134419922-134419944
Sequence GTGCCTGCAGTGTGCACAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062044772_1062044776 15 Left 1062044772 9:134419922-134419944 CCGGCTGTGCACACTGCAGGCAC 0: 1
1: 0
2: 0
3: 26
4: 286
Right 1062044776 9:134419960-134419982 CCGTGTGCCCACTCCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062044772 Original CRISPR GTGCCTGCAGTGTGCACAGC CGG (reversed) Intronic
900600572 1:3501082-3501104 CTGCCTGTAGTGTGCCCAGCAGG - Exonic
900625545 1:3606972-3606994 GTGACTCCAGGCTGCACAGCAGG - Intronic
900900063 1:5510032-5510054 GAGCCTGCAGTGTGCAGAACTGG + Intergenic
901034591 1:6328804-6328826 TCCCCTCCAGTGTGCACAGCAGG - Intronic
901212251 1:7533281-7533303 CTGCCTGCAGAGGGCACAGCCGG - Intronic
901290264 1:8118534-8118556 TTTCCTGCAGTGTGCTCACCTGG + Intergenic
901429944 1:9207744-9207766 GTGCCTACTATGTGCAGAGCAGG + Intergenic
901668706 1:10841433-10841455 GTCCCTGCTGTGAGCACTGCTGG - Intergenic
904035391 1:27556123-27556145 TTCCCGGCACTGTGCACAGCAGG - Intronic
904094375 1:27965987-27966009 GTCCCTGCTGTGTGGACAGAAGG - Intronic
904255112 1:29249762-29249784 GTGTCTCCAGAGAGCACAGCAGG - Intronic
905627240 1:39497358-39497380 TTGCATGCAGTGTGGCCAGCTGG + Intronic
905630136 1:39513997-39514019 TTGCCTTCAGTGCCCACAGCAGG - Intronic
905667624 1:39772193-39772215 TTGCCTTCAGTGCCCACAGCAGG + Intronic
907558471 1:55366555-55366577 CTGACTGCTGTGTGCACTGCTGG + Intergenic
907616498 1:55932067-55932089 GTGCTTTGAGTGTGCACAGATGG + Intergenic
910011695 1:82471726-82471748 GTTCCTGGAGGGTGGACAGCAGG - Intergenic
910526557 1:88185650-88185672 GAGCTTGCAGTGAGCACAGATGG - Intergenic
912185275 1:107267734-107267756 GTGCTTGCTGTGTGCTCAACTGG - Intronic
914863393 1:151405268-151405290 TTGCCTGCAGTGGTCCCAGCAGG - Exonic
915214256 1:154329343-154329365 GTTACTGCAGTGTGCTCTGCAGG + Intronic
918758534 1:188370470-188370492 GTACATGCAGTGTTCACAGAAGG - Intergenic
919720694 1:200831264-200831286 TTGCTTGCTGTGTGCCCAGCAGG + Intronic
922490666 1:226013977-226013999 ATGGCTGCAGTGTGCAGTGCGGG - Intergenic
922978201 1:229802571-229802593 GTGTCTGCTGTGTGTCCAGCTGG + Intergenic
923429170 1:233904702-233904724 GTGCCTCGAGAGCGCACAGCTGG + Intergenic
924947000 1:248853294-248853316 GTGGCTGCTGTGTGAACAGGGGG - Intronic
1062814827 10:491841-491863 GGCCCTGCAGGGTGCACAGCAGG - Intronic
1063124110 10:3124847-3124869 GTGCCTGCAGGCAGCACAGCGGG - Intronic
1063957329 10:11279532-11279554 AGGCCTGCAGTGTGGACTGCTGG - Intronic
1064686366 10:17866489-17866511 GTGCCTTCTGTGAGCACGGCAGG + Intronic
1065238899 10:23685943-23685965 GAGCCTGCAGTGAGCAGAGATGG - Intergenic
1067267165 10:44756335-44756357 GTGACTGCAGTGGGCGCAGTGGG - Intergenic
1067936069 10:50613210-50613232 GTGTCAGCAGAGTGCACAGAAGG - Intronic
1068225940 10:54107469-54107491 GTGGCAGCAACGTGCACAGCAGG + Intronic
1069568248 10:69478126-69478148 GGGGCAGCAGTGTGCAGAGCAGG + Intronic
1069778971 10:70943089-70943111 GTGCCCGCAGTGTAAACTGCTGG + Intergenic
1072249410 10:93569665-93569687 GAGGCTGCAGTGTGCACTGGGGG + Intronic
1072344457 10:94489542-94489564 GTTCCTGCAGGGTGGACAACTGG + Intronic
1074048465 10:109860828-109860850 GTCCCTGGAGTGTTCACAGCAGG + Intergenic
1075051458 10:119185359-119185381 GTGCCTGCAGCTAGCAGAGCTGG - Intergenic
1076273826 10:129179371-129179393 TTGCCTGCACTGTGCTCAGAAGG - Intergenic
1076415192 10:130281518-130281540 GGGGCTGCTCTGTGCACAGCAGG + Intergenic
1076545818 10:131245170-131245192 CTGCCACCAGTGTGCAGAGCAGG + Intronic
1076644517 10:131943475-131943497 GTACTGGCAGGGTGCACAGCAGG - Intronic
1076652006 10:131996492-131996514 TTCCCAGCAGTGAGCACAGCCGG - Intergenic
1076755809 10:132571071-132571093 GGGCGTGCACTGTGCCCAGCTGG - Intronic
1077343293 11:2035522-2035544 GGGCGTGCAGTGAGCCCAGCTGG - Intergenic
1078069884 11:8101550-8101572 AGGCCTGCAGTGCACACAGCGGG - Exonic
1078666599 11:13331099-13331121 GTAGCTCCAGTGAGCACAGCAGG - Intronic
1079360886 11:19769555-19769577 GTGCCTCCAGTGAGCACCACTGG - Intronic
1079551517 11:21704704-21704726 CTGCTTGCTGTTTGCACAGCAGG + Intergenic
1081631010 11:44689899-44689921 TTGCCTGCAGTATGCAGAACAGG - Intergenic
1081657330 11:44866110-44866132 GTGGCAGCAGAGGGCACAGCTGG - Intronic
1082792956 11:57359777-57359799 CTGCCTGCAAGGGGCACAGCTGG - Intronic
1083492658 11:63024216-63024238 GTGCCTGCAGTGCGCCCGCCTGG + Intergenic
1083898367 11:65631720-65631742 GAGCCTGCACTGTGATCAGCAGG - Intronic
1084172614 11:67407857-67407879 ATGCCTGTCGTGTGCTCAGCCGG + Intronic
1084370110 11:68735729-68735751 GTTCCTGCAGTGTTTACAGTCGG - Intronic
1084447557 11:69212604-69212626 GTGGGTGCAGTGTCCACACCAGG - Intergenic
1084656580 11:70523176-70523198 CTGGCTGCTGTGTGCACACCGGG + Intronic
1084973622 11:72784646-72784668 GGGACTGCAGTGGGCAGAGCAGG - Intronic
1085017773 11:73186373-73186395 GTGCCTGCTGTGTGCCAGGCAGG + Intergenic
1086131855 11:83409474-83409496 ATGCCTGGAGTGGGCACAGAAGG - Intergenic
1087037053 11:93766299-93766321 GTGATTTCAGTTTGCACAGCGGG + Intronic
1087936126 11:104036619-104036641 GTGCCTGCTGTGTGGCCAGGTGG - Exonic
1088461512 11:110088359-110088381 GTGTCTGCCTTGTACACAGCAGG + Intergenic
1089784616 11:120899002-120899024 GTGCCTGCTGTGTACAAAACAGG + Intronic
1090870259 11:130738299-130738321 GTCCCTGCAGTGTGCTGGGCGGG - Intergenic
1090944017 11:131413744-131413766 GTTCCTGCCGTGTGGGCAGCAGG + Intronic
1202826279 11_KI270721v1_random:90711-90733 GGGCGTGCAGTGAGCCCAGCTGG - Intergenic
1093906077 12:24693237-24693259 TTGCCTCCAGTGGGCTCAGCTGG + Intergenic
1094027372 12:25973343-25973365 GTGCATGCAGTGTGAACTGAGGG + Intronic
1096051116 12:48608871-48608893 GTGTCTGCAGTTTTCACAGTGGG + Intergenic
1096426707 12:51510062-51510084 GTTCCAGCAGCCTGCACAGCTGG + Exonic
1096749823 12:53751671-53751693 GGGCCTGCAGGGTGCGGAGCGGG + Intergenic
1099021633 12:77413015-77413037 GTGCCTCAAGTGTGCAGACCAGG - Intergenic
1101970106 12:109307066-109307088 GAGCCTGCTGTGTGCAGAGCTGG - Intronic
1102633353 12:114301169-114301191 GCTCCTGCAGTGCTCACAGCTGG + Intergenic
1102902923 12:116652596-116652618 GTGCCTGAAATGTCCACAGAGGG + Intergenic
1103912318 12:124359381-124359403 ATGCCTGCTGTGAGCAGAGCAGG + Intronic
1105768176 13:23581208-23581230 GAGCTTGCAGTGCGCAGAGCGGG - Intronic
1107015837 13:35707003-35707025 GTGCCTGCAGAGTTCACATTTGG - Intergenic
1107816154 13:44246344-44246366 CAGCCTGCAGTGTGGACAGAAGG + Intergenic
1110683351 13:78342526-78342548 GTGCCAGCAGAATGCACAGAAGG - Intergenic
1113313958 13:109158936-109158958 GTGACTGGAGTGGGCACAGTGGG - Intronic
1113419777 13:110162160-110162182 GTGCCTTCGGTGTGCAGTGCTGG - Intronic
1113922451 13:113920760-113920782 GTGGCTGCTGAGTGCAGAGCTGG + Intergenic
1116715207 14:48417869-48417891 GTGCCGGTGGTGTCCACAGCAGG + Intergenic
1117024495 14:51606426-51606448 AGGCCTGCAGAGTGCCCAGCAGG - Intronic
1117729711 14:58710245-58710267 GTGACTGGTGTGGGCACAGCTGG + Intergenic
1117893369 14:60450653-60450675 GGGCCTTCAGTGAACACAGCGGG + Intronic
1118673459 14:68156559-68156581 GTGCATGCAGTATGCCCAGAAGG + Intronic
1118758264 14:68861216-68861238 GTGCCTGCAGTTTGCAGATGAGG - Intergenic
1119509425 14:75199220-75199242 GTGCCTGCATTGTGCAGAGGTGG + Intergenic
1119544674 14:75463014-75463036 GTGCCTGCCATGAGCAGAGCTGG + Intronic
1120187312 14:81407011-81407033 GTGACTGCAGTGTGGTCAGCTGG - Intronic
1122264583 14:100540678-100540700 GGGCCTGCTGTGCGCTCAGCAGG + Intronic
1122863020 14:104591081-104591103 GGGCCTGCAGTGTGCTGGGCAGG - Intronic
1122886395 14:104712320-104712342 CAGCCTGCAGGGTGCACAGTGGG + Intronic
1123005961 14:105323992-105324014 GTGACTCCAGTGTTGACAGCAGG - Intronic
1123704587 15:22941731-22941753 GGGGCTGCTGTGTGCAAAGCTGG - Intronic
1123704758 15:22943099-22943121 TGGCCTGCCTTGTGCACAGCAGG - Intronic
1125731510 15:41894935-41894957 CTGCCTGCAGTGGGCCCAGGCGG - Intergenic
1126298915 15:47173298-47173320 ATGTCTGCAGTGCGCACAGGAGG - Intergenic
1127841818 15:62838377-62838399 GTGCCTGGAGTGTGCTGTGCCGG - Intronic
1129466750 15:75728375-75728397 TTCCCTGCAGTCTGCCCAGCTGG - Intergenic
1130322520 15:82852974-82852996 GTGTGTGCAGAGTGGACAGCAGG + Intronic
1132723114 16:1326547-1326569 GTGACTGCAGGGTGCGTAGCCGG - Exonic
1133837835 16:9382241-9382263 GTGCCTACAGAGTAGACAGCAGG + Intergenic
1133838066 16:9384026-9384048 GTGCCTGCAGAGTAGACAGTGGG - Intergenic
1134187617 16:12097009-12097031 CTCCCTGCAGTGTGCAAAGGGGG + Intronic
1134189876 16:12112810-12112832 GTACCTGCACTGGGTACAGCTGG + Intronic
1137845432 16:51683603-51683625 GTGCCTGATGTGTGGAGAGCTGG + Intergenic
1138399313 16:56732573-56732595 GACCGTGCAGTGTGAACAGCTGG + Intronic
1138782309 16:59803720-59803742 GTTCTTTCAGTGTGCATAGCAGG - Intergenic
1139375675 16:66495010-66495032 GTCCCTTCAGGGTGCAAAGCAGG + Intronic
1139662311 16:68429556-68429578 GTGCATGCAGTGGGCACCACAGG + Intronic
1140503394 16:75454158-75454180 GGGGCTGCACTGTGCACTGCAGG + Intronic
1141560045 16:84862008-84862030 GTACCTGCAATGTGGACAGCTGG + Intronic
1141886575 16:86896339-86896361 GTGCCTGCTGTGTGCACGGTGGG - Intergenic
1142029928 16:87833394-87833416 ATGCCTGGACTGTTCACAGCAGG + Intronic
1142373958 16:89697372-89697394 GTGGCTACAGCGTGCACAGATGG - Exonic
1142858242 17:2745264-2745286 GTGTCTGCTGTGCGCACATCTGG + Intergenic
1143270663 17:5672425-5672447 GGCCCTGCAGTGTGTACAGTTGG + Intergenic
1144452089 17:15389642-15389664 GTACCTGCTGTGTGCAAGGCAGG - Intergenic
1144584962 17:16482358-16482380 GTGCCTGGAGGGGGCACTGCAGG + Intronic
1144772883 17:17769661-17769683 CTGCCTGAAGTGTGCCCATCTGG - Intronic
1147137330 17:38441871-38441893 GTGGCTGGAGTGTGGCCAGCTGG + Intronic
1147422735 17:40330730-40330752 GTGCCAGCTGTCTGCTCAGCTGG + Intronic
1147758787 17:42784403-42784425 GTCCCTGTAGGGTCCACAGCAGG - Exonic
1148331375 17:46815777-46815799 GTGGCTGCAGGGGGCACAGCTGG - Intronic
1150419351 17:65017574-65017596 CTGCCTGCAGTGGGCCCCGCTGG + Intronic
1151261050 17:72916376-72916398 GTTCCTCCAATGAGCACAGCTGG + Intronic
1152555147 17:81049341-81049363 GCGCCCTCAGTGTGGACAGCTGG + Intronic
1154206215 18:12339174-12339196 GAGCTTGCAGTGTGCCCAGATGG + Intronic
1155365554 18:25046098-25046120 GTTCCTGCATTGAGCATAGCAGG - Intergenic
1157736028 18:50050286-50050308 TTGCCAGATGTGTGCACAGCAGG + Intronic
1158938950 18:62389351-62389373 GTGCCAGCAGTGAGCACAGGCGG + Exonic
1159261796 18:66022833-66022855 ATGACTGCAGTCTGGACAGCTGG - Intergenic
1160218948 18:76958528-76958550 GTGCCTGCTGTATGCACAGAAGG + Intronic
1160428245 18:78793005-78793027 GTGCATGGCGTGTGGACAGCAGG + Intergenic
1161979033 19:7621010-7621032 GTACCTGCTGTACGCACAGCTGG - Exonic
1163147325 19:15389158-15389180 GAGCTTGCAGTGTGCAGAGATGG + Intronic
1163373710 19:16916911-16916933 CTGGTTGCAGTGTGCATAGCTGG - Intronic
1165424116 19:35736606-35736628 GTGTCTGCTGGGAGCACAGCGGG + Intronic
1167610581 19:50506102-50506124 AGGCATGCAGTGTGCGCAGCCGG + Exonic
925013245 2:501924-501946 CTGCAGGCAGTGTGCACACCAGG - Intergenic
925259954 2:2520522-2520544 GTGCCTGCAATTTGCACAGGGGG - Intergenic
925329391 2:3046806-3046828 GTGCCTGCCTGGTGCACAGCAGG - Intergenic
925770723 2:7280513-7280535 GTACCTGCCGTGTGCCCAGCAGG + Intergenic
926677689 2:15639963-15639985 CTCCCTACAGTGTGCACAGTGGG + Intergenic
929536750 2:42788604-42788626 GTGCCTGCAATGCGCAAAGTGGG + Exonic
929969593 2:46562631-46562653 CTGCCTGCTGTGTGCAAAGTGGG + Intronic
930023529 2:47015652-47015674 GTACCCGCAGTGTGCTAAGCAGG - Intronic
930517889 2:52431510-52431532 GTGCCTGGAGTCTGGACATCTGG + Intergenic
935337941 2:102034451-102034473 GTCCCTGCAGTGGGCTCAGAAGG - Intergenic
935594186 2:104867042-104867064 GCGACTGCGGTGGGCACAGCAGG - Intergenic
937353646 2:121184717-121184739 GTGGCAGCAGTGTCCACAGGTGG - Intergenic
937900195 2:127014033-127014055 GAGCCTGCAGTGTGGCCAGCAGG - Intergenic
938114719 2:128595313-128595335 GTGCCTACAGTGTCCCCAGCAGG + Intergenic
938977259 2:136491918-136491940 GGGCATGCAGGTTGCACAGCTGG - Intergenic
939961183 2:148567418-148567440 GTGAATGCAGTGTTAACAGCAGG - Intergenic
945881185 2:215326941-215326963 TGGGCTGCAGTGTGTACAGCTGG - Exonic
948807216 2:240458233-240458255 GGCCCTGAGGTGTGCACAGCAGG + Intronic
1169473468 20:5908914-5908936 GTGCTTGCAGTGAGCCCAGATGG + Intergenic
1171282454 20:23912219-23912241 GTTGCTGCAGTGTCCTCAGCAGG + Intergenic
1172773530 20:37394891-37394913 GTGCATGCTGTGTGTACATCTGG + Intronic
1173670090 20:44792960-44792982 GTGCCAGCAGGGTGCACGGCTGG - Intronic
1174065391 20:47860887-47860909 GAGACAGCGGTGTGCACAGCTGG - Intergenic
1175597879 20:60249838-60249860 GTGCCTGCCATGCCCACAGCTGG - Intergenic
1175799225 20:61791779-61791801 CTGCCTGACCTGTGCACAGCCGG - Intronic
1176217414 20:63954834-63954856 GGGCCTGCCCTGTGCACAGACGG - Intronic
1178500713 21:33123654-33123676 GGGCCTGACCTGTGCACAGCAGG - Intergenic
1178500926 21:33124918-33124940 GGGCCTGACCTGTGCACAGCAGG + Intergenic
1179035160 21:37753139-37753161 ATGCCTGCAGCGTGTGCAGCTGG + Intronic
1179122435 21:38560350-38560372 GGGCCTGAGGTGTGAACAGCTGG - Intronic
1179292597 21:40031756-40031778 GTGCCAGCAGAGTGTACAGGAGG - Intronic
1179441810 21:41400077-41400099 GTGCCTGGTGTGTCCACAACAGG - Intronic
1180087696 21:45515434-45515456 GTCCCTGCACTGTGCCCCGCGGG - Exonic
1180131325 21:45828951-45828973 GTGCCAGCGGTGTGGACAGAAGG + Intronic
1180182775 21:46125244-46125266 CTGCCTGCCGTGTGCATTGCAGG + Exonic
1180845358 22:18978304-18978326 GTGCCACCTGGGTGCACAGCTGG + Intergenic
1182107208 22:27698094-27698116 GTGACTTCTGTGTGGACAGCTGG - Intergenic
1183814811 22:40290753-40290775 GGGCCTGCTGTGTTCACTGCTGG + Intronic
1183815171 22:40293741-40293763 GGGCCTGCTGTGTTCACTGCTGG + Intronic
1184240564 22:43209443-43209465 GTGACCGCTGTGTGCCCAGCTGG - Intronic
1184688449 22:46106788-46106810 CTGCGTGCAGTGTGCAGGGCCGG + Intronic
1184808509 22:46812328-46812350 GTGCCTGCTGTGCCCACAGGGGG - Intronic
1184818548 22:46891072-46891094 GTGCTTGCATTGTGTTCAGCTGG + Intronic
1184859702 22:47166188-47166210 GTATCTTCAGTGTGCACAGAGGG + Intronic
1184977292 22:48071407-48071429 GAGCCAGCAGTGTTCACAGGAGG - Intergenic
1185225075 22:49647628-49647650 GGGCCTGCAGTGTGTGTAGCTGG - Intronic
949461440 3:4299288-4299310 GTGCTTGCAGTCCACACAGCAGG - Intronic
950108528 3:10403724-10403746 GTGGATGCTGGGTGCACAGCAGG - Intronic
950427779 3:12933964-12933986 GTCCCTGCAGAGTGGACAGGTGG - Intronic
950572434 3:13809693-13809715 CTGGCTGCAGGGTCCACAGCTGG + Intergenic
952869179 3:37882850-37882872 GTGGCTCCAGTGTGCATACCTGG - Intronic
952919899 3:38277044-38277066 CTGGCAGCAGGGTGCACAGCAGG - Exonic
953431574 3:42844668-42844690 GTGCCTTCAGTGAGCACCTCTGG + Intronic
953561245 3:43995366-43995388 GTGCCTGCTGTGTGCGGAGCTGG - Intergenic
953582017 3:44166119-44166141 GAGCTTGCAGTGTGCAGAGATGG + Intergenic
953703558 3:45214603-45214625 GTGCCTCCAAAGTGCACAGTGGG - Intergenic
953878684 3:46680592-46680614 GTGCCAGCAGAGTGCCCAGGAGG - Intronic
954407444 3:50353351-50353373 GGCCCTGCTGTGTGCACTGCTGG + Exonic
954627235 3:52029155-52029177 CTGCCTGCACAGGGCACAGCTGG - Intergenic
958490002 3:94760586-94760608 GTGGATGCTGCGTGCACAGCGGG - Intergenic
960965124 3:123099415-123099437 GTGCCAGAAGTGTGCTCAGATGG + Intronic
961328823 3:126127198-126127220 GGGACTGGAGTGTGCAGAGCTGG + Intronic
961545649 3:127630964-127630986 CTGCCTGCAGTCCTCACAGCTGG - Intronic
961682574 3:128608739-128608761 GCGCCTGCTGTGTGCTCTGCAGG + Intergenic
962171327 3:133104607-133104629 GGCCCTGCTGTGTGCACAGCTGG + Intronic
962407451 3:135112090-135112112 GTGGCTGGAGTGAGCTCAGCGGG + Intronic
967845005 3:194036108-194036130 GGGCCTGAAGTTTGCACAGTTGG + Intergenic
968453994 4:688193-688215 GTGCCAGCATTGTGGGCAGCAGG + Intronic
968648860 4:1752586-1752608 GTGCCTGCACCGTGCCCATCCGG - Intergenic
969059974 4:4426609-4426631 GCGCCTGCATAGAGCACAGCTGG - Intronic
971375131 4:26050216-26050238 GTGTGTGCAGGGTGCACTGCTGG - Intergenic
975544218 4:75545393-75545415 GTTCCTTCAGTTTGCAGAGCAGG - Intronic
976426191 4:84905826-84905848 GACCCTGCAGTGTGAACAGTTGG - Intronic
978701443 4:111651314-111651336 GTGCAGACAGTGTGCACTGCTGG + Intergenic
979665256 4:123304218-123304240 GTGACTGAAGGGAGCACAGCAGG - Intronic
981767970 4:148273857-148273879 GATCCTGCAGTGTGCACAGGGGG + Intronic
984821623 4:183887552-183887574 GTGCATGCAGGGCGCTCAGCAGG - Intronic
985548571 5:521998-522020 GGGGCTGCAGAGTGCACAGTGGG + Intronic
985552499 5:540750-540772 GTGCCTGAAGTGGGTGCAGCCGG - Intergenic
989540975 5:42618481-42618503 GAGCCTGCTGTGTGCAGAGTTGG + Intronic
994362274 5:98865873-98865895 ATTCATGCATTGTGCACAGCAGG + Intronic
994514990 5:100760169-100760191 GAGCCTGCAGTGAGCCCAGATGG - Intergenic
995047667 5:107670121-107670143 GAGCCCCCAGTGTGCGCAGCCGG - Intronic
995617341 5:113979838-113979860 GAGCCAGCACTGTGGACAGCTGG - Intergenic
996948430 5:129096414-129096436 GTGCCAGAAGTGTCCAAAGCAGG + Intronic
997704037 5:135930362-135930384 GTGCCTCCAGTGCGCGGAGCCGG + Intronic
1001047405 5:168385338-168385360 GCGCCTGGAGCTTGCACAGCAGG + Exonic
1001334195 5:170784044-170784066 GTGGCTGTAGTGAGGACAGCAGG - Intronic
1003174379 6:3744424-3744446 GTGCCAGGAGGATGCACAGCAGG + Intronic
1004957432 6:20745040-20745062 CTGCCTGCAGGGCTCACAGCTGG - Intronic
1006017575 6:31094523-31094545 GAGCCTGCAGCTTGCACAGAAGG - Intergenic
1006643104 6:35498374-35498396 AGGCCTGCAGGGCGCACAGCGGG + Exonic
1006884433 6:37369131-37369153 GTCCCAGCTGTGTGCAGAGCAGG + Exonic
1008070867 6:47097585-47097607 CTCCCTGCAGGGTGAACAGCTGG - Intergenic
1009988854 6:70815891-70815913 ATGCCTGCAGTGTGTAAGGCAGG + Intronic
1010167622 6:72935489-72935511 GTGCCGGCAGTATGCTTAGCAGG - Intronic
1010368899 6:75084906-75084928 GTGCCTTTAGTTAGCACAGCGGG - Exonic
1013246848 6:108294983-108295005 GAGCCTTCAGCGTGCACGGCGGG + Exonic
1014014653 6:116516385-116516407 GCTCCTGCAGTGTGATCAGCAGG + Exonic
1016131799 6:140481977-140481999 GAGGCTGCAGTGAGCACAGATGG + Intergenic
1016383731 6:143511648-143511670 GAGCCTGCAGAGAGGACAGCCGG - Exonic
1017813556 6:158001138-158001160 GTGCATGCAGGGTGCAGAGGAGG - Intronic
1017926519 6:158915572-158915594 GTGCCTGCAGTGTCTTCAGTGGG + Intergenic
1019476882 7:1248605-1248627 GCGCCAGCTGTGAGCACAGCGGG + Intergenic
1020040231 7:4996092-4996114 GTCCCTGCTGTGTGGACAGAAGG - Intronic
1021573619 7:22088494-22088516 GTGCAGGTAGTGTGCACAGAAGG - Intergenic
1021952631 7:25790080-25790102 TTCCCTCAAGTGTGCACAGCTGG - Intergenic
1022222337 7:28325611-28325633 GTGGCTGAAGTATGCATAGCAGG - Intronic
1024060830 7:45697331-45697353 GAGGCTGCAGTGGGCACAGCTGG - Intronic
1024234859 7:47390344-47390366 CTGGCTGCAGTGTGCAGAGCTGG - Intronic
1025013965 7:55423940-55423962 GTGTCTACAGAGGGCACAGCGGG - Intronic
1025190579 7:56892783-56892805 GTGCGTGCAGTGTGAATGGCAGG + Intergenic
1025681373 7:63684193-63684215 GTGCGTGCAGTGTGAATGGCAGG - Intergenic
1026735378 7:72945621-72945643 GCGCCTGGAGTGGGCACATCAGG + Exonic
1026785718 7:73300551-73300573 GCGCCTGGAGTGGGCACATCAGG + Intergenic
1027108347 7:75419385-75419407 GCGCCTGGAGTGGGCACATCGGG - Exonic
1029458130 7:100681168-100681190 GGGCCAGCAGTTTGCACAGGAGG - Exonic
1029595572 7:101535853-101535875 GGGCCTGGAGTGTGCAGAGATGG + Intronic
1030563081 7:111115730-111115752 GTGGCTGCAGTGAGCCCAGATGG - Intronic
1030775842 7:113533489-113533511 GTGCCTGCACCGTGCACAAGCGG + Intergenic
1032403163 7:131637838-131637860 CTGCCTGCAGGGCCCACAGCAGG - Intergenic
1035225226 7:157428887-157428909 GGGCCTGAAGTGGCCACAGCTGG + Intergenic
1035242800 7:157543180-157543202 GTGCCAGCAGTCTGAACAGGAGG + Intronic
1035565465 8:637884-637906 CTGCCTGCAGTGGCCAGAGCAGG - Intronic
1035678089 8:1468896-1468918 GAGGCTGGAGTGAGCACAGCAGG - Intergenic
1038022265 8:23560606-23560628 GTGACTGCAGTGGTCCCAGCGGG + Intronic
1038565492 8:28616859-28616881 TTCCCTTCAGTGTCCACAGCTGG - Intronic
1039123511 8:34175360-34175382 CTGCGTGCAGACTGCACAGCTGG + Intergenic
1040574997 8:48644182-48644204 CTGACTGCAGGTTGCACAGCTGG + Intergenic
1041898654 8:62956725-62956747 TTGCCTACACTGTGCACAACAGG + Intronic
1042554259 8:70021044-70021066 GTGCCTGCTGTGTGCCGAACGGG + Intergenic
1043483253 8:80673995-80674017 CTACCTGCAGTGTGCAGTGCTGG + Intronic
1047185215 8:122627019-122627041 GTGCCTGAAGATTGAACAGCAGG + Intergenic
1047645265 8:126863466-126863488 ATTCCTTCAGTGTGCACTGCTGG + Intergenic
1048039405 8:130710943-130710965 ATGCCCTCAGTGGGCACAGCTGG + Intergenic
1048897256 8:139003221-139003243 GTGTCTCGAGTGTGGACAGCAGG - Intergenic
1049338272 8:142098116-142098138 AAGCCTGCAGACTGCACAGCGGG + Intergenic
1049504182 8:142986033-142986055 GTGGCTGGTGTGTGGACAGCAGG - Intergenic
1049618996 8:143589400-143589422 GTGCCTGCAGGCTGCCCAGCGGG + Exonic
1049786093 8:144451534-144451556 CTGCCTGGACTGTGCCCAGCGGG - Intronic
1050755087 9:8992379-8992401 TTGCCTCCAGTCTGCACACCAGG - Intronic
1053622754 9:39836984-39837006 GAGCCTGCAGTGTGCCAAGATGG + Intergenic
1056395300 9:86176191-86176213 GGGGCTGCAGAGGGCACAGCTGG + Intergenic
1056602989 9:88061123-88061145 GTGCAGGGAGTGTGGACAGCAGG - Intergenic
1056999864 9:91497518-91497540 GTGCCTCCATTGTGCACAAACGG + Intergenic
1057837361 9:98455823-98455845 TTGCCTGCAAGGTTCACAGCCGG - Intronic
1058562693 9:106246661-106246683 GAGCCTGCAGTGAGCAGAGATGG - Intergenic
1058804296 9:108576453-108576475 GAGCCTCCATTGGGCACAGCTGG + Intergenic
1058956174 9:109950761-109950783 ATGACAGCAGTGTTCACAGCTGG - Intronic
1059329898 9:113528328-113528350 GTGGCTGCAGTGGGCAGGGCAGG + Intronic
1060411624 9:123404122-123404144 GGGTCTGCAGTGGGCACATCAGG + Intronic
1060655796 9:125371810-125371832 GTGTCTGCCCTGTGCACAGGTGG - Intergenic
1061134993 9:128728761-128728783 GAGCTTGCAGTGAGCACAGATGG - Intergenic
1061853840 9:133430723-133430745 GAGCCTGCAGTGAGCAGAGAGGG - Intronic
1061960772 9:133987944-133987966 GCACCTGCTGTGTGCAGAGCCGG - Intronic
1062044772 9:134419922-134419944 GTGCCTGCAGTGTGCACAGCCGG - Intronic
1062141970 9:134964274-134964296 GTGCCTACTGTGTGCTAAGCTGG + Intergenic
1062541603 9:137044079-137044101 CTGCCTGCAGTGTGCAGTGTGGG - Intronic
1185984388 X:4814606-4814628 GAGCTTGCAGTGAGCACAGATGG + Intergenic
1190362422 X:49661976-49661998 GTGCCTTCTGTGGGCCCAGCTGG + Intergenic
1194676118 X:96795944-96795966 GTGTCTGCAGTTTTCACATCTGG + Intronic
1194744157 X:97610119-97610141 GTGCCTGCAATGTACACTGAGGG + Intergenic
1195687235 X:107598063-107598085 GAGCCTGCAGAGTGGACACCAGG - Exonic
1195977713 X:110545551-110545573 TTGCAGGCAGAGTGCACAGCAGG - Intergenic
1196145004 X:112306830-112306852 GTTTCTGCAGTGGCCACAGCAGG + Intergenic
1200162418 X:154016355-154016377 GGGGCTGCAGAGTGCACTGCGGG - Intronic