ID: 1062044776

View in Genome Browser
Species Human (GRCh38)
Location 9:134419960-134419982
Sequence CCGTGTGCCCACTCCTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062044770_1062044776 22 Left 1062044770 9:134419915-134419937 CCTGTGGCCGGCTGTGCACACTG 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1062044776 9:134419960-134419982 CCGTGTGCCCACTCCTGCAGAGG No data
1062044769_1062044776 23 Left 1062044769 9:134419914-134419936 CCCTGTGGCCGGCTGTGCACACT 0: 1
1: 0
2: 0
3: 4
4: 123
Right 1062044776 9:134419960-134419982 CCGTGTGCCCACTCCTGCAGAGG No data
1062044772_1062044776 15 Left 1062044772 9:134419922-134419944 CCGGCTGTGCACACTGCAGGCAC 0: 1
1: 0
2: 0
3: 26
4: 286
Right 1062044776 9:134419960-134419982 CCGTGTGCCCACTCCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062044776 Original CRISPR CCGTGTGCCCACTCCTGCAG AGG Intronic
No off target data available for this crispr