ID: 1062045961

View in Genome Browser
Species Human (GRCh38)
Location 9:134424668-134424690
Sequence CCAGTGTTCCACATCTGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062045961_1062045970 19 Left 1062045961 9:134424668-134424690 CCAATTCAGATGTGGAACACTGG 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1062045970 9:134424710-134424732 CCAGGTGGCTGGAGAGGACCTGG No data
1062045961_1062045968 13 Left 1062045961 9:134424668-134424690 CCAATTCAGATGTGGAACACTGG 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1062045968 9:134424704-134424726 CACTGGCCAGGTGGCTGGAGAGG No data
1062045961_1062045965 4 Left 1062045961 9:134424668-134424690 CCAATTCAGATGTGGAACACTGG 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1062045965 9:134424695-134424717 TGAAGCCTGCACTGGCCAGGTGG No data
1062045961_1062045966 8 Left 1062045961 9:134424668-134424690 CCAATTCAGATGTGGAACACTGG 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1062045966 9:134424699-134424721 GCCTGCACTGGCCAGGTGGCTGG No data
1062045961_1062045963 -4 Left 1062045961 9:134424668-134424690 CCAATTCAGATGTGGAACACTGG 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1062045963 9:134424687-134424709 CTGGAGTTTGAAGCCTGCACTGG No data
1062045961_1062045964 1 Left 1062045961 9:134424668-134424690 CCAATTCAGATGTGGAACACTGG 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1062045964 9:134424692-134424714 GTTTGAAGCCTGCACTGGCCAGG No data
1062045961_1062045971 20 Left 1062045961 9:134424668-134424690 CCAATTCAGATGTGGAACACTGG 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1062045971 9:134424711-134424733 CAGGTGGCTGGAGAGGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062045961 Original CRISPR CCAGTGTTCCACATCTGAAT TGG (reversed) Intronic
901072119 1:6526261-6526283 CCAGTGTCCCTCATTTGAAAGGG - Intronic
904189813 1:28734984-28735006 CCAGTATTGCACATCTGGGTGGG + Intergenic
904381477 1:30114049-30114071 CCACTGTTTCACATAAGAATTGG - Intergenic
909944435 1:81648005-81648027 CTAGTGACCCACATCTAAATAGG - Intronic
910035728 1:82785229-82785251 CCAGTGTTCTATATCTTGATTGG + Intergenic
916364598 1:164010586-164010608 CCATTGTTGCAAATCTGTATAGG - Intergenic
917180576 1:172292538-172292560 CAAGTGTTTCCCATATGAATAGG - Intronic
920576678 1:207065901-207065923 TCACTGCTCCATATCTGAATGGG + Intronic
924710004 1:246523677-246523699 CCAGGGTTCCAGATCCCAATGGG - Intergenic
1064740264 10:18425922-18425944 CCAATTTTCCACATATGAGTAGG + Intronic
1065317762 10:24480902-24480924 CCAGGGTTGCACATCTGCTTGGG + Intronic
1068497126 10:57796874-57796896 CCATTATTCTACATCTTAATAGG - Intergenic
1074267259 10:111916917-111916939 CAAGATTTCCACATCTGAAGAGG + Intergenic
1081237358 11:40661026-40661048 CCAGCATTCCAAATCTCAATGGG + Intronic
1084801572 11:71547584-71547606 CCAGTGTGCCTCAGCTGACTTGG - Intronic
1087057935 11:93951780-93951802 GCAGTGTCTCACATCTGAAGAGG - Intergenic
1090173579 11:124626559-124626581 CCTGTGTTCCCCATCGGACTAGG + Exonic
1091540373 12:1455287-1455309 CTAGTGTTCCACAGATCAATAGG - Intronic
1092406639 12:8226169-8226191 CCAGTGTTACATATCTGACGGGG - Intronic
1098786913 12:74770905-74770927 CCAGTGTATCTCCTCTGAATAGG - Intergenic
1099758221 12:86883688-86883710 CCAGTTTTCCACTTCAAAATCGG + Intergenic
1101660332 12:106759650-106759672 CCAGTGTTTCTGATCTGATTTGG + Intronic
1106889615 13:34230360-34230382 CCAGTGTTACACAGCTTAAAAGG - Intergenic
1108648427 13:52452522-52452544 GCACAGTTCCACATCTGATTAGG - Intergenic
1110165838 13:72442115-72442137 CCTGTGTTACACATCTGCTTTGG - Intergenic
1111528755 13:89509211-89509233 CCAGTGTTCCACATCTTCCAGGG + Intergenic
1112577933 13:100653527-100653549 CCTGTGTCCCACATGTGAACAGG - Intronic
1114427399 14:22635675-22635697 TCACTGTTCCACATCTGTGTGGG - Intergenic
1115291299 14:31775869-31775891 TCAGGGTTCTACATCTGCATAGG + Intronic
1117669068 14:58087569-58087591 GCAGTGTTCCACAGCTGACCTGG + Intronic
1121691740 14:95883118-95883140 CCTGTGTTCTTCATCTGAAAAGG + Intergenic
1122711203 14:103659574-103659596 CCAGTGTTCCACATTGCATTTGG + Intronic
1129669825 15:77601282-77601304 CCAGTGTTCCCCAGCTTACTTGG + Intergenic
1130186442 15:81688102-81688124 CCAGACTTCTACATTTGAATTGG - Intergenic
1135763661 16:25158116-25158138 CCTGTGTTCCACATCCACATTGG + Intronic
1138420003 16:56892852-56892874 CCCGTGTTCAACATCAGAAGGGG + Intronic
1139673186 16:68505635-68505657 CCAGTATTCCACATTTGATTTGG + Intergenic
1140328630 16:74030414-74030436 CCAGCCTTCCACATCTGCAGCGG - Intergenic
1140641762 16:76982178-76982200 CCAGTGTTCTAGAGTTGAATGGG - Intergenic
1140841330 16:78842162-78842184 CAAGTGTTCCACTGCTGAATCGG - Intronic
1143436345 17:6930402-6930424 CCAGTGTTCAACAGATGAGTAGG + Intronic
1145759737 17:27419377-27419399 CCAGTGGCCCACACCTGCATGGG - Intergenic
1145809147 17:27754418-27754440 CCAGTGCTCCTCATATTAATGGG - Intergenic
1146159705 17:30553306-30553328 CCAGTGGCCCACACCTGCATGGG - Intergenic
1148475045 17:47923068-47923090 CCCGTGCTCCCCATCTGAGTGGG + Exonic
1153175065 18:2362462-2362484 CCTGGGTTCGACATTTGAATTGG + Intergenic
1153274466 18:3354301-3354323 CCTGTGTTTAACATCTGACTTGG + Intergenic
1156119282 18:33822185-33822207 CCAGTGTGACACATTTGAAATGG - Intergenic
1156354918 18:36332580-36332602 CAAGTGTTTCACACCTGCATTGG - Intronic
927388415 2:22563661-22563683 TCAGTTTTCCATATCTAAATTGG + Intergenic
932299805 2:70658328-70658350 AAAGTGTGCCACATCTGAATAGG + Exonic
932481755 2:72044518-72044540 TCAGTATTCTACATCTGACTGGG - Intergenic
933211689 2:79578044-79578066 CCACTATTCCACATAAGAATCGG - Intronic
935928775 2:108100203-108100225 GCAGTTTTCCATATCTGTATGGG - Intergenic
937594334 2:123655607-123655629 GCAGTCTCCCACACCTGAATAGG - Intergenic
938711573 2:133979885-133979907 CCCATCTTTCACATCTGAATAGG + Intergenic
944186117 2:196950718-196950740 GCAGTGGTCCACACCTGAGTGGG - Intergenic
944981339 2:205124093-205124115 AAAGTGTTACACATCTGGATTGG + Intronic
946703100 2:222432102-222432124 CCCGTGTGCCAAATCGGAATTGG + Intronic
947963173 2:234257149-234257171 CCAGTGTTACACATTTACATTGG - Intergenic
1172658861 20:36553304-36553326 TCACTGATCCACATCTCAATGGG + Intergenic
1177336010 21:19728736-19728758 CCAGTGTTCTACTTTTAAATTGG - Intergenic
1179602009 21:42485534-42485556 CCTGTTCTCCACATTTGAATAGG + Intronic
1180791572 22:18577984-18578006 CCCCTGACCCACATCTGAATGGG + Intergenic
1181230168 22:21417327-21417349 CCCCTGACCCACATCTGAATGGG - Intergenic
1181248481 22:21517536-21517558 CCCCTGACCCACATCTGAATGGG + Intergenic
950757285 3:15186008-15186030 ACAGTGTTCCACATCTGGGCAGG + Intergenic
953841760 3:46395182-46395204 CCAGTGCTCCCCATTTCAATGGG - Intergenic
954783659 3:53077930-53077952 CCTGGGTTCCACATCTGAAAAGG - Intronic
956527378 3:70179758-70179780 CCTCTGTTCTATATCTGAATGGG + Intergenic
957205865 3:77198020-77198042 CCAGTGATACAAATGTGAATAGG - Intronic
960360170 3:116701305-116701327 CCTGAGCACCACATCTGAATTGG - Intronic
962152573 3:132908372-132908394 GAAGTGTTCCACATCTTTATTGG - Intergenic
966741741 3:183240656-183240678 CCAGATTTACACATCAGAATGGG + Intronic
967506844 3:190262057-190262079 CCAGTGTTCCAGATCTACAATGG + Intergenic
968764959 4:2463316-2463338 CCAAATTTCCACATCTGAAGGGG - Intronic
970495262 4:16618653-16618675 CCAGTATTCCATACCTGAATCGG - Intronic
971315389 4:25563705-25563727 CCAGTTTTTCAGATCTGAAAGGG + Intergenic
974018707 4:56674069-56674091 TCAGGGTTCCACAGCTGAAAAGG - Intronic
974853300 4:67429375-67429397 CCAGTGTTCTAGATCCTAATAGG - Intergenic
977455419 4:97253901-97253923 GCAGTGTTACTCATCTGATTGGG - Intronic
981572977 4:146173344-146173366 CCATTGTTCCACATCCTCATGGG - Intergenic
982342388 4:154314848-154314870 TCAGTGTTTCACATGTGAATGGG + Intronic
992889132 5:81187943-81187965 TCATTGTTCCAAATCTGAAATGG + Intronic
996783401 5:127212981-127213003 CCAGTTCTATACATCTGAATAGG - Intergenic
996916306 5:128715755-128715777 CCAGTGTGACACCTTTGAATTGG + Intronic
997197566 5:131990044-131990066 CCTGAGTGCCAGATCTGAATGGG + Intronic
999615101 5:153414674-153414696 ATAGTGTTAGACATCTGAATAGG + Intergenic
1001150297 5:169221535-169221557 ACAGTATTACACATCTGAATGGG + Intronic
1003602290 6:7528702-7528724 CCAGTTCTGCACATCTGAGTGGG + Intergenic
1004867488 6:19868566-19868588 CCAGTTTTCCAAGTCTGAACTGG - Intergenic
1009468091 6:63998666-63998688 CCAGTCTTCCAGATTTGCATTGG - Intronic
1010620001 6:78062400-78062422 CCAGTGTTCCCCAGTTGAACAGG + Intergenic
1021599341 7:22349119-22349141 CCAGTGTTCCACAGATCAGTAGG + Intronic
1023525203 7:41095253-41095275 CCATAGTTCTACCTCTGAATGGG - Intergenic
1028095156 7:86751285-86751307 CCAGTGTGACACATCTGAAGAGG - Intronic
1028275067 7:88845451-88845473 CCATTGTCCCTCATCTGAAGAGG - Intronic
1032703529 7:134403000-134403022 CCAGTTTGGCTCATCTGAATAGG - Intergenic
1032790129 7:135236561-135236583 CCAGTTTTCCAAGTCTGGATAGG + Intronic
1036963061 8:13266905-13266927 CCAGTCTTCCTCATCTTCATTGG + Intronic
1037257341 8:16970170-16970192 CCAGTGTTCCTCTTATGAATTGG - Intergenic
1040924437 8:52663318-52663340 CCAGTGTTACACAGCTTCATAGG + Intronic
1042382344 8:68131496-68131518 TCAGTGTTAAACATTTGAATTGG + Intronic
1042984241 8:74565819-74565841 CCATGGTTCCACAGCTGTATAGG + Intergenic
1048225461 8:132580993-132581015 CCAGGAGTCCACATCTGTATGGG - Intronic
1050278125 9:4021595-4021617 CCAGTGTTCAACTGTTGAATAGG - Intronic
1050569636 9:6924337-6924359 CCAGGGTTGCAGATCTGTATGGG + Intronic
1052030719 9:23625486-23625508 CCAGTGTTCCTCATTTGTCTGGG + Intergenic
1056555935 9:87687195-87687217 CCAGTGTTCAATAGCAGAATAGG - Intronic
1056967117 9:91173537-91173559 GCATTGTTCCAAATCTCAATTGG - Intergenic
1057137320 9:92701839-92701861 CCTTTGTTCCTCATCTTAATGGG + Intergenic
1057222326 9:93263908-93263930 CCAGTGTTGCACACCTGGAAGGG - Exonic
1062045961 9:134424668-134424690 CCAGTGTTCCACATCTGAATTGG - Intronic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1190877017 X:54467291-54467313 TCTGTGTTCCACATCAGACTGGG + Intronic
1194572982 X:95575354-95575376 CCAGTGTTCCACAGCAAAAATGG - Intergenic
1196006160 X:110839425-110839447 CCAGTGACCCAGAGCTGAATTGG + Intergenic
1199674485 X:150175124-150175146 GCAGTGTTCCATATCTTAAGGGG + Intergenic
1199835742 X:151588713-151588735 TCACTCTTCCACATCTGAAGAGG - Intronic