ID: 1062046152

View in Genome Browser
Species Human (GRCh38)
Location 9:134425489-134425511
Sequence AGGCCCTCAGACGACCCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062046152_1062046175 28 Left 1062046152 9:134425489-134425511 CCAGCGGGGTCGTCTGAGGGCCT No data
Right 1062046175 9:134425540-134425562 GCAGGGTGGGGGGTGGGGGGGGG No data
1062046152_1062046166 17 Left 1062046152 9:134425489-134425511 CCAGCGGGGTCGTCTGAGGGCCT No data
Right 1062046166 9:134425529-134425551 CCTGCGTGGCGGCAGGGTGGGGG No data
1062046152_1062046170 23 Left 1062046152 9:134425489-134425511 CCAGCGGGGTCGTCTGAGGGCCT No data
Right 1062046170 9:134425535-134425557 TGGCGGCAGGGTGGGGGGTGGGG No data
1062046152_1062046160 11 Left 1062046152 9:134425489-134425511 CCAGCGGGGTCGTCTGAGGGCCT No data
Right 1062046160 9:134425523-134425545 GCACCTCCTGCGTGGCGGCAGGG No data
1062046152_1062046158 6 Left 1062046152 9:134425489-134425511 CCAGCGGGGTCGTCTGAGGGCCT No data
Right 1062046158 9:134425518-134425540 CACAGGCACCTCCTGCGTGGCGG No data
1062046152_1062046163 15 Left 1062046152 9:134425489-134425511 CCAGCGGGGTCGTCTGAGGGCCT No data
Right 1062046163 9:134425527-134425549 CTCCTGCGTGGCGGCAGGGTGGG No data
1062046152_1062046159 10 Left 1062046152 9:134425489-134425511 CCAGCGGGGTCGTCTGAGGGCCT No data
Right 1062046159 9:134425522-134425544 GGCACCTCCTGCGTGGCGGCAGG No data
1062046152_1062046167 18 Left 1062046152 9:134425489-134425511 CCAGCGGGGTCGTCTGAGGGCCT No data
Right 1062046167 9:134425530-134425552 CTGCGTGGCGGCAGGGTGGGGGG No data
1062046152_1062046169 22 Left 1062046152 9:134425489-134425511 CCAGCGGGGTCGTCTGAGGGCCT No data
Right 1062046169 9:134425534-134425556 GTGGCGGCAGGGTGGGGGGTGGG No data
1062046152_1062046171 24 Left 1062046152 9:134425489-134425511 CCAGCGGGGTCGTCTGAGGGCCT No data
Right 1062046171 9:134425536-134425558 GGCGGCAGGGTGGGGGGTGGGGG No data
1062046152_1062046173 26 Left 1062046152 9:134425489-134425511 CCAGCGGGGTCGTCTGAGGGCCT No data
Right 1062046173 9:134425538-134425560 CGGCAGGGTGGGGGGTGGGGGGG No data
1062046152_1062046164 16 Left 1062046152 9:134425489-134425511 CCAGCGGGGTCGTCTGAGGGCCT No data
Right 1062046164 9:134425528-134425550 TCCTGCGTGGCGGCAGGGTGGGG No data
1062046152_1062046162 14 Left 1062046152 9:134425489-134425511 CCAGCGGGGTCGTCTGAGGGCCT No data
Right 1062046162 9:134425526-134425548 CCTCCTGCGTGGCGGCAGGGTGG No data
1062046152_1062046172 25 Left 1062046152 9:134425489-134425511 CCAGCGGGGTCGTCTGAGGGCCT No data
Right 1062046172 9:134425537-134425559 GCGGCAGGGTGGGGGGTGGGGGG No data
1062046152_1062046168 21 Left 1062046152 9:134425489-134425511 CCAGCGGGGTCGTCTGAGGGCCT No data
Right 1062046168 9:134425533-134425555 CGTGGCGGCAGGGTGGGGGGTGG No data
1062046152_1062046174 27 Left 1062046152 9:134425489-134425511 CCAGCGGGGTCGTCTGAGGGCCT No data
Right 1062046174 9:134425539-134425561 GGCAGGGTGGGGGGTGGGGGGGG No data
1062046152_1062046157 3 Left 1062046152 9:134425489-134425511 CCAGCGGGGTCGTCTGAGGGCCT No data
Right 1062046157 9:134425515-134425537 TTGCACAGGCACCTCCTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062046152 Original CRISPR AGGCCCTCAGACGACCCCGC TGG (reversed) Intronic