ID: 1062046919

View in Genome Browser
Species Human (GRCh38)
Location 9:134428607-134428629
Sequence GATTCCCAGGGGGGAAGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062046919_1062046926 -10 Left 1062046919 9:134428607-134428629 CCTAACCTTCCCCCCTGGGAATC 0: 1
1: 0
2: 1
3: 12
4: 199
Right 1062046926 9:134428620-134428642 CCTGGGAATCCCCCCGAAAGAGG No data
1062046919_1062046927 -4 Left 1062046919 9:134428607-134428629 CCTAACCTTCCCCCCTGGGAATC 0: 1
1: 0
2: 1
3: 12
4: 199
Right 1062046927 9:134428626-134428648 AATCCCCCCGAAAGAGGCTGCGG No data
1062046919_1062046933 21 Left 1062046919 9:134428607-134428629 CCTAACCTTCCCCCCTGGGAATC 0: 1
1: 0
2: 1
3: 12
4: 199
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062046919 Original CRISPR GATTCCCAGGGGGGAAGGTT AGG (reversed) Intronic
900437771 1:2639713-2639735 GATTCCGAGCGGGGAAGGCGAGG + Intronic
901207640 1:7505943-7505965 GGTTCTCAGGCGGGCAGGTTTGG + Intronic
902408542 1:16199660-16199682 GAATCCCAGTTGGGAAGGATGGG - Intronic
902713509 1:18256589-18256611 GTTTCCCAAGGGGGAAGGAAAGG + Intronic
903468460 1:23568440-23568462 GAGTCCCAGCGGGGGAGGTGCGG - Intergenic
904163571 1:28538332-28538354 AAACCCCAGGGGGGAAGTTTTGG - Intronic
904404230 1:30275516-30275538 GAATTCCAGGGGGCAGGGTTGGG - Intergenic
904681413 1:32232012-32232034 AATACCCAGGGGAGAAGGTGTGG + Intergenic
905018225 1:34792015-34792037 GATTCCCAGGGGACTTGGTTAGG - Intronic
905802101 1:40850904-40850926 GATTCCCAGGGGTGTGGCTTGGG - Intergenic
906320912 1:44814872-44814894 GATCTCCAGGGGGGCAGGTCTGG - Intronic
906713770 1:47952069-47952091 GAGTGCCAGGGAGGAAGCTTTGG - Intronic
908169260 1:61488504-61488526 GTTTCCCAGGGGGCAAGGACTGG + Intergenic
909144732 1:71916049-71916071 TATTCCCAGAGGGTAAGGGTGGG + Intronic
910400558 1:86833948-86833970 GATGTCCAGGGGGTGAGGTTGGG - Intergenic
910441567 1:87258186-87258208 GGGTCTCAGGAGGGAAGGTTGGG - Intergenic
912240059 1:107897136-107897158 AATTCCCAAGGGAGGAGGTTTGG + Intronic
913572422 1:120134033-120134055 GATTCAGACAGGGGAAGGTTGGG - Intergenic
915972799 1:160366318-160366340 AATTCCCAGTGGGTCAGGTTGGG + Intergenic
916016400 1:160753803-160753825 GATTCCCAGAGGGCCAGGTGTGG + Exonic
917743380 1:177983597-177983619 GATTTCCAGGGTGGAAGCCTTGG + Intronic
918102435 1:181387947-181387969 GGGTCCCAAGGGGGAAGGTTGGG - Intergenic
918353888 1:183686777-183686799 GATGCTCAGGGGGGAAGGCAGGG - Intronic
920227956 1:204451480-204451502 GCTTCTCAGGGAGGAAGGTAAGG - Intronic
920457027 1:206109333-206109355 GATTCCCTGGGGGGTGGGTTGGG + Intergenic
920895523 1:210044994-210045016 GATTCCCAGTGTTGAAGGTGGGG - Intronic
921937897 1:220811693-220811715 TCTTCCCAGTGGGGAAGGTGGGG + Intronic
924652237 1:245940070-245940092 AATTCCCTGAGGGGAAGGTGAGG - Intronic
1062791042 10:306904-306926 GATTCCCAGGGTTGGAGGTGGGG + Intronic
1071726569 10:88204116-88204138 GATCCCCAGGGTGTAAGGATGGG - Intergenic
1072662130 10:97369634-97369656 GTTTTCCAGTGGGGAAGGTTTGG - Intronic
1073387824 10:103142133-103142155 GTTTTCCAGGGGGCAAGGATGGG + Intronic
1073663905 10:105508674-105508696 GATTCCCAGGGCAGGAGGTAGGG + Intergenic
1074230736 10:111532379-111532401 GAATCCCACGGGGGAGGGATTGG + Intergenic
1074603242 10:114935804-114935826 GATTCCCAGTGTTGGAGGTTGGG - Intergenic
1076899972 10:133333573-133333595 GGATCCCAGGTGGGAAGGGTCGG + Intronic
1077340651 11:2024902-2024924 GACCCCCAGGCGGGAGGGTTGGG + Intergenic
1080616240 11:33947309-33947331 AAATCCCAGGGGGGTGGGTTTGG - Intergenic
1080640259 11:34154516-34154538 GTGTCCCAGCGGGGATGGTTAGG - Intronic
1083187455 11:61026068-61026090 GGTTTCCAGGGGACAAGGTTAGG - Intergenic
1083309706 11:61777947-61777969 GATTCCCAGGGGCGCAGTTCCGG - Intronic
1084358273 11:68653423-68653445 GCTTCCCAGGGGGGCAGGCAGGG + Intergenic
1086808449 11:91273355-91273377 GATTCCCAGTGTTGAAGGTGGGG + Intergenic
1088421120 11:109648155-109648177 GATTCCCAGGGCTGGAGGTGTGG + Intergenic
1088437375 11:109830155-109830177 GACTCCAATGGGGGAAGGTTGGG + Intergenic
1090403981 11:126466396-126466418 GTATCCCAGGGAGGAAGGCTGGG + Intronic
1202823636 11_KI270721v1_random:80091-80113 GACCCCCAGGCGGGAGGGTTGGG + Intergenic
1091693546 12:2612758-2612780 GAGGCCCAGGGTGGAAGGTGTGG - Intronic
1094476129 12:30842059-30842081 GGTTCCCTTTGGGGAAGGTTGGG - Intergenic
1096477006 12:51914414-51914436 GATGGCCAGAGGGGAAGGTGAGG - Intronic
1101339158 12:103826171-103826193 GATTCCCTGGAGAGGAGGTTGGG - Intronic
1101640511 12:106583232-106583254 GATGCCCAGGGAGGAAGGGAGGG - Intronic
1102598933 12:114014055-114014077 GATCCCCAGGGGGGAAGGGGAGG - Intergenic
1103988167 12:124780873-124780895 GATTCCCAGGGTGCAGGGGTGGG - Intronic
1105529545 13:21205554-21205576 GATTCCCAGGTGGGAATTTCTGG - Intergenic
1105734459 13:23253704-23253726 GATTCCCAATGTGGAAGGTGGGG + Intronic
1106123882 13:26884251-26884273 GATTCCCAGTGTGGGAGGTGGGG + Intergenic
1109336878 13:61005554-61005576 GATTCCCAGTGTTGAAGGTGGGG + Intergenic
1110099677 13:71582002-71582024 GATGCCCAGTGAGGAAGATTTGG + Intronic
1111394829 13:87651774-87651796 GACTCCAAAGGGGGGAGGTTGGG - Intergenic
1111522891 13:89428275-89428297 CATTCCCCGGGGGGAAGGGGTGG - Intergenic
1113876612 13:113598556-113598578 GAGTCACAGGAGGGCAGGTTAGG - Intronic
1117413179 14:55468783-55468805 GGTTCCCAGGAGGGAAGGGTTGG - Intergenic
1119001300 14:70884387-70884409 CATTTCCAGCTGGGAAGGTTAGG + Intergenic
1122290462 14:100678023-100678045 GGGTCCCAGGGTGGAGGGTTAGG + Intergenic
1122846523 14:104503070-104503092 GATTCCCAGGGTTGGAGGTGGGG + Intronic
1125546191 15:40507336-40507358 GCTTCCCAGTGGGGGAGTTTGGG + Intergenic
1129992662 15:79978321-79978343 GATTCCCAGAGGGTAAGGCAAGG - Intergenic
1132575740 16:662974-662996 GGTTCCCAGCGGGGAAGTCTTGG + Intronic
1134861881 16:17567593-17567615 GATTCCCTGGGGGGATGGGGGGG + Intergenic
1136016345 16:27403446-27403468 GATTCCCTGGGGGGAGAGTGGGG + Intronic
1137407881 16:48204519-48204541 GCTTCCCGGGGTGCAAGGTTTGG + Intronic
1148824508 17:50382591-50382613 GATTCCCAGGGAGGAATGAAAGG + Exonic
1150142821 17:62744370-62744392 GGTTCCCAGGGGAGCAGGTAAGG - Exonic
1150716030 17:67573300-67573322 GATCACCAGGGGAGAGGGTTTGG + Intronic
1150974987 17:70075226-70075248 GATTCCCAGGGAGGAACTGTAGG + Exonic
1152062642 17:78089916-78089938 CTTTCCCAGAGGGGAAAGTTGGG + Intronic
1152409126 17:80113071-80113093 GATTCCCAGGGGAGAGTCTTGGG - Intergenic
1152581431 17:81166966-81166988 GACTCCCACGGGGGCAGGCTGGG - Intergenic
1152730505 17:81967471-81967493 GATTCCCTGGTGGAAAGGATCGG + Intergenic
1155660093 18:28238960-28238982 GATCCCCAGTGGGGAGTGTTGGG - Intergenic
1156157033 18:34315284-34315306 GATTCCTTTGGGGGAAGATTGGG + Intergenic
1157606952 18:48931903-48931925 GACACCCTGGGGGGAAGGTGGGG + Intronic
1160911004 19:1473792-1473814 GTGTCCCAGGGTGGAAGGTGGGG - Exonic
1164443851 19:28300549-28300571 GACTCAGAAGGGGGAAGGTTAGG + Intergenic
1165073275 19:33267764-33267786 ACTTCCCAGGGTGGAAGGATAGG - Intergenic
1166298235 19:41899352-41899374 GATCCCCACAGGGGAAAGTTTGG + Intronic
1167155559 19:47736541-47736563 GCTGCCCAGGAGGGAATGTTGGG + Intronic
1167215944 19:48164676-48164698 GATTCCCAGGGAGGAAGTTTTGG + Intronic
927272475 2:21227498-21227520 GGTTACCAGGGGTGAAGGGTTGG - Intergenic
931714185 2:65016124-65016146 GATTCCCAGGAGGAAAGGCAAGG - Intronic
934606489 2:95699280-95699302 TTTCCCCAGGGGGGAAGGTGGGG + Intergenic
934859482 2:97751938-97751960 GATCCCCAGTGTGGAAGGTGGGG - Intergenic
936013282 2:108939469-108939491 GATTACCAGGTGGGGAGGTCAGG + Intronic
937169934 2:119855759-119855781 GAATTCCATGGGGGAATGTTTGG + Intronic
937370853 2:121296327-121296349 GGTTCCTAGGTGGGAAGGATGGG - Intergenic
939664298 2:144931580-144931602 GATTGCCAGGGGCTGAGGTTAGG - Intergenic
943119877 2:183722584-183722606 GGTTACCAGGGCAGAAGGTTGGG + Intergenic
945558251 2:211305922-211305944 GATTCCCAGTGTTGAAGGTGGGG + Intergenic
946180856 2:217948201-217948223 GATTCCCAGCAGGGAGGGGTCGG + Intronic
946323873 2:218972718-218972740 GAAAACCAGGGGGAAAGGTTGGG + Intergenic
946622313 2:221573109-221573131 GATTTCCCGGGGGCAGGGTTGGG + Intronic
947037457 2:225875512-225875534 GATTCCCAGGTGATATGGTTTGG - Intergenic
947811283 2:233005402-233005424 GATTCTCAGCTGGGAAGGTGAGG + Intronic
948075777 2:235164169-235164191 GGTTCTCAAGGGGGAAGGTGGGG + Intergenic
1168962515 20:1878986-1879008 GCTTCCCAAGGGGCAAGCTTTGG + Intergenic
1169227687 20:3866396-3866418 GATTGCCAGTGGGGAAGGTCTGG - Exonic
1169290150 20:4342727-4342749 GAATCCCAGGATGGAAAGTTTGG - Intergenic
1169954600 20:11087311-11087333 GATTGCCAGAGGGGAAGGCATGG - Intergenic
1172283937 20:33727879-33727901 GATTCCCAGGAAGGTAGGTGGGG + Intergenic
1172905897 20:38369057-38369079 GATTCCCAGGGCTGAAGTTCAGG - Exonic
1173643983 20:44622270-44622292 GATGCCCAGGGGGCAGAGTTGGG + Intronic
1175994822 20:62807349-62807371 GGTTCCCAGTGGGGCAGATTTGG - Intronic
1176044682 20:63086491-63086513 CATTCCCAGAGCGCAAGGTTGGG - Intergenic
1177894839 21:26845766-26845788 GGTTCCCAGGAGGGAGGGTTCGG + Intergenic
1180049478 21:45324749-45324771 AATTCCCAGGGCAGAAGGTGGGG + Intergenic
1181582212 22:23834647-23834669 GATTCCCAAGTGGGCAGGTGGGG + Exonic
1183275870 22:36897397-36897419 GATTCCCAGTGTTGAAGGTGGGG + Intergenic
951396349 3:22172135-22172157 GGTTCTGAGGGGTGAAGGTTAGG - Intronic
951524147 3:23637821-23637843 GAGTCCTAGGGGAGAAGTTTAGG + Intergenic
952165428 3:30743647-30743669 GATTCCCTGAGTGGATGGTTAGG + Intronic
954440352 3:50518367-50518389 GACTCCCAGGGGGCAAGGCAGGG + Intergenic
954803116 3:53198867-53198889 GATTCACAGTGGGGAAGCTGAGG + Intergenic
955974882 3:64470241-64470263 CATCCCCAGTGGGGAAGATTTGG - Intergenic
960811591 3:121632091-121632113 GATTACCAAGGAGGTAGGTTGGG - Exonic
962238243 3:133728058-133728080 GATAGCCAGGGAGAAAGGTTGGG - Intergenic
962387064 3:134940061-134940083 GATTCCCAGAGGGAAAGGGAAGG + Intronic
966759570 3:183405483-183405505 GATTTCCAGGGGTTAAGGGTGGG - Intronic
968693412 4:2008457-2008479 GATTCCCAGGGGGCGAGGAGGGG + Intronic
969138636 4:5050908-5050930 CATTCCCAGGGAGAATGGTTTGG + Intergenic
969489897 4:7493173-7493195 GAATCTCAGGTGGGAGGGTTTGG + Intronic
969733525 4:8971533-8971555 AATTTCCAGGGGGGAAGGGGGGG - Intergenic
974188322 4:58469091-58469113 GATTCCCAGGTGTAAAAGTTTGG - Intergenic
975160943 4:71122739-71122761 GATGCCGAGGGGGGATGGTCTGG - Intergenic
975421337 4:74167556-74167578 GATTCCCAGGGTACAGGGTTGGG + Intronic
976218029 4:82732880-82732902 GATTCCCAGGCAGGAAGCATTGG + Intronic
977871506 4:102095980-102096002 GATTCTCAGTGTTGAAGGTTGGG + Intergenic
980292183 4:130857781-130857803 CAATCCCAGGGGGGAATGATAGG - Intergenic
981052472 4:140323102-140323124 GATTCCCAGTGTTGAAGGTGGGG + Intronic
982487624 4:155986404-155986426 GATTTCCAGGGGTTAAGTTTAGG - Intergenic
986356082 5:6927668-6927690 GATTGTCAGGGGGGTGGGTTTGG - Intergenic
986435843 5:7730033-7730055 GACTCCAAAGGGGGAAGGGTAGG - Intronic
987134016 5:14884290-14884312 GAGTCCCAGTGGAGAAGATTGGG + Intergenic
991188451 5:63839110-63839132 GATCCCCAGTGCTGAAGGTTGGG - Intergenic
991325174 5:65423159-65423181 GATTCAGAAGGGGGAAGGATAGG + Intronic
993286303 5:86001941-86001963 GATTGCCAGGGGCTAAGGGTAGG - Intergenic
993413898 5:87602146-87602168 GAGTTTCAGGGGGGAAGCTTGGG - Intergenic
996165470 5:120216949-120216971 GATTCCCAGTGTTGAAGGTGGGG + Intergenic
997058385 5:130471577-130471599 AAGACCCTGGGGGGAAGGTTGGG - Intergenic
997865573 5:137459853-137459875 GCTGCCCAGAGGGGCAGGTTTGG + Intronic
998956784 5:147446851-147446873 TATTCACAGGGTGGAAGGATTGG - Intronic
999156955 5:149464896-149464918 GATTCCCAGGGGTGAGGGTCTGG - Intergenic
1000878403 5:166668526-166668548 AATGCCCAGTGGGGAAGGTGAGG - Intergenic
1001969981 5:175947685-175947707 GTTTCCCAGTGGGGAAGATGGGG - Intronic
1002247456 5:177896079-177896101 GTTTCCCAGTGGGGAAGATGGGG + Intergenic
1002359899 5:178662190-178662212 GATTCCAAGGGTGGATGGTCTGG - Intergenic
1002707247 5:181170145-181170167 GCTCCCCAGAGGGGAAGGGTGGG - Intergenic
1003222027 6:4169272-4169294 GAATCACAGGGGGAAAGGGTGGG + Intergenic
1005369782 6:25120183-25120205 AATTCCCAGGGGGTGAGGTATGG - Intergenic
1006527116 6:34616031-34616053 GCTTCCCAAGGGGAAAGGTCAGG + Intronic
1011094996 6:83651314-83651336 GTTTCCCAAGGTGGAAGCTTAGG + Intronic
1016088984 6:139952482-139952504 GTTTCCCAAGGTGGAAGCTTAGG + Intergenic
1017508758 6:155093374-155093396 GATTGCCATTGGGGAAGGTGTGG + Intronic
1017587932 6:155947305-155947327 GATTCCTAGGCGGGAAGGGGTGG + Intergenic
1021605934 7:22409724-22409746 GAGTCCCAGGGGAAGAGGTTAGG + Intergenic
1021944865 7:25716680-25716702 GATTCCCAGGAAGGAAGGCATGG - Intergenic
1022416444 7:30181668-30181690 GATTCCCAGTGGGGTAGTGTTGG - Intergenic
1023515193 7:40994695-40994717 GATTCCCAGGGTTGGAGGTGGGG + Intergenic
1023551154 7:41371089-41371111 GATTTCCAGATGGGGAGGTTTGG + Intergenic
1023825659 7:44007182-44007204 GCTTCCCAGAGAGGAAGGTAAGG - Intronic
1025972701 7:66342875-66342897 GATTCCCAGTGTTGAAGGTGGGG - Intronic
1026089212 7:67285958-67285980 GCTTCCCAGAGAGGAAGGTAAGG - Intergenic
1026725039 7:72864392-72864414 GCTTCCCAGAGAGGAAGGTAAGG + Intergenic
1027118802 7:75501276-75501298 GCTTCCCAGAGAGGAAGGTAAGG - Intergenic
1027272994 7:76534183-76534205 GCTTCCCAGAGAGGAAGGTAAGG + Intergenic
1027326444 7:77053267-77053289 GCTTCCCAGAGAGGAAGGTAAGG + Intergenic
1029397678 7:100319479-100319501 GCTTCCCAGAGAGGAAGGTAAGG - Intronic
1029514681 7:101017844-101017866 GAGTCCCAGGGGGAAAGGAAGGG - Intronic
1029718685 7:102348741-102348763 GCTTCCCAGAGAGGAAGGTAAGG + Intergenic
1029753930 7:102560514-102560536 GCTTCCCAGAGAGGAAGGTAAGG - Intronic
1029771880 7:102659604-102659626 GCTTCCCAGAGAGGAAGGTAAGG - Intronic
1030418324 7:109273420-109273442 GATTTCCGGGGGATAAGGTTGGG - Intergenic
1030493854 7:110272612-110272634 GATTGCCATGGGTGAAGGTGGGG - Intergenic
1036307916 8:7615422-7615444 TATTCCCTTGGGGGCAGGTTGGG + Intergenic
1036358771 8:8063423-8063445 TATTCCCTTGGGGGCAGGTTGGG + Intergenic
1036559657 8:9890844-9890866 GAATCCCAGTGGGAAAGGTCAGG + Intergenic
1036892187 8:12603529-12603551 TATTCCCTTGGGGGCAGGTTGGG - Intergenic
1036899734 8:12661505-12661527 TATTCCCTTGGGGGCAGGTTGGG - Intergenic
1037007920 8:13805414-13805436 GATTCTCACAGGGGAAGGCTAGG - Intergenic
1037297842 8:17419982-17420004 GATTGCCAGGGGCCAAGGGTAGG - Intergenic
1037487215 8:19358898-19358920 GATGCCCAGGGTGGAAGGTGTGG - Intronic
1037979923 8:23246169-23246191 GATTCCCAAGGTGGAATCTTAGG + Intronic
1038412265 8:27367899-27367921 GATTCCCAGTGTGGGAGGTGGGG - Intronic
1038922174 8:32096832-32096854 GATTCCCAGTGTTGAAGGTGGGG - Intronic
1045432871 8:102129539-102129561 GATTGCCAGGGGCTAGGGTTAGG - Intergenic
1052686720 9:31765678-31765700 GATTCCCAGGTGATATGGTTTGG - Intergenic
1055503337 9:76923561-76923583 GGTTTCCAGGGGTTAAGGTTTGG - Intergenic
1057083111 9:92187602-92187624 GATTGCCAGAGGGGAGGCTTTGG - Intergenic
1057177321 9:93009833-93009855 GATACCCAGTGGGGATGGTTGGG + Intronic
1060824427 9:126679867-126679889 GATTCCAATGGGGGAAGTGTTGG - Intronic
1062046919 9:134428607-134428629 GATTCCCAGGGGGGAAGGTTAGG - Intronic
1062273298 9:135719516-135719538 GAGTCCCAGTGGGGAGGGGTGGG + Intronic
1062727436 9:138083568-138083590 GATTCCCAGGGGTGGGGGGTGGG - Intronic
1185703971 X:2252763-2252785 GATTCCCTGGGGTGGGGGTTAGG + Intronic
1186364571 X:8877848-8877870 GAGACCCAGGGGAGAAGGTTGGG - Intergenic
1186542409 X:10414074-10414096 GATCCCCAGTGGCAAAGGTTAGG - Intergenic
1186694130 X:12011592-12011614 GACTCCCAGGGCTGGAGGTTTGG + Intergenic
1187231476 X:17427559-17427581 GATTCCCACAGCTGAAGGTTTGG + Intronic
1188089618 X:25947702-25947724 GATTACCAGAGGCTAAGGTTGGG + Intergenic
1191043821 X:56114255-56114277 GACTTCCTGGGGGGAAGGGTTGG - Intergenic
1191845566 X:65545134-65545156 GGTTCTCAGGGAGGAAGCTTTGG - Intergenic
1199404628 X:147442662-147442684 GAGACTCAGTGGGGAAGGTTAGG + Intergenic
1199953903 X:152727340-152727362 GATTCCTAGGGTGAAAGTTTTGG - Intergenic