ID: 1062046920

View in Genome Browser
Species Human (GRCh38)
Location 9:134428612-134428634
Sequence GGGGGGATTCCCAGGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 346}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062046920_1062046927 -9 Left 1062046920 9:134428612-134428634 CCTTCCCCCCTGGGAATCCCCCC 0: 1
1: 0
2: 0
3: 36
4: 346
Right 1062046927 9:134428626-134428648 AATCCCCCCGAAAGAGGCTGCGG No data
1062046920_1062046933 16 Left 1062046920 9:134428612-134428634 CCTTCCCCCCTGGGAATCCCCCC 0: 1
1: 0
2: 0
3: 36
4: 346
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062046920 Original CRISPR GGGGGGATTCCCAGGGGGGA AGG (reversed) Intronic
900008147 1:79257-79279 GTGGGGGTTCCCAGGGGAGGGGG - Intergenic
900100493 1:960230-960252 GGGGGGCTTCCCGGGGAAGAAGG + Intergenic
900118746 1:1039806-1039828 CGGGGGATGCCCAGGGAGGAGGG + Intronic
900146278 1:1160241-1160263 GGGGGGATGCGCAGGGAGGAGGG + Intergenic
901133163 1:6975445-6975467 TGTGGAATTCCCAGGAGGGACGG + Intronic
901151231 1:7103119-7103141 GTGGGGGTTCCCAGCGGGGTGGG + Intronic
902676017 1:18009134-18009156 GTGGGGATCCTCAGGAGGGAAGG - Intergenic
903224168 1:21885492-21885514 CTGGGGATGCCCAGGGAGGATGG - Intronic
903728762 1:25473678-25473700 GGGTGGATTCCCTGAAGGGAAGG + Intronic
904008351 1:27375474-27375496 GGAAGGATTCCCAGTGGAGATGG - Intergenic
904681412 1:32232007-32232029 GGGGTAATACCCAGGGGAGAAGG + Intergenic
904795879 1:33056037-33056059 GGGGTGAATACCAGGGGGGAGGG - Intronic
905184704 1:36188044-36188066 GGAGGGATCTCCAGAGGGGATGG - Intergenic
905263839 1:36737920-36737942 TGGGGGAAGCACAGGGGGGACGG - Intergenic
905276395 1:36821422-36821444 GAGGGGCTTCCCAGGGGGCGAGG + Intronic
905676990 1:39833467-39833489 GGAGTGATTCCCAGAGGAGAAGG - Intergenic
905878375 1:41448019-41448041 TGGGGCATTGCCAGAGGGGATGG + Intergenic
906264955 1:44421610-44421632 GGAGGGATTAGCAGGGGGAAGGG + Intronic
906949344 1:50321957-50321979 GGGTGGGTTCTCAGGAGGGATGG - Intergenic
908173039 1:61526864-61526886 GGGTGGAGTCCCAGAGGGTAGGG - Intergenic
908763279 1:67531693-67531715 GGGGGCAGTCTCAGGGTGGAAGG + Intergenic
911845613 1:102747581-102747603 GTGGGGATCCCTAGTGGGGATGG + Intergenic
912206589 1:107515883-107515905 GGGGTGCTGCCCAGGGAGGAAGG - Intergenic
914431561 1:147624164-147624186 GGGCAGCTTCCCAGGAGGGATGG + Exonic
914433564 1:147640959-147640981 TGGGGAATTCCCCGGGGAGATGG - Intronic
914490249 1:148146989-148147011 GGCGGGCTTCCCTGGGAGGAAGG + Intronic
914678994 1:149925972-149925994 TGGGGGTATCCCAGGTGGGAGGG + Exonic
915916978 1:159946064-159946086 GGGTGGATCCCCTGGGAGGAGGG - Intergenic
916879338 1:169004170-169004192 GAGGGGTTTCCCCTGGGGGAAGG + Intergenic
920189083 1:204180817-204180839 GAGGGGATTGGCATGGGGGATGG + Intergenic
920227957 1:204451485-204451507 GAGGGGCTTCTCAGGGAGGAAGG - Intronic
920457025 1:206109328-206109350 GGCTGGATTCCCTGGGGGGTGGG + Intergenic
921390287 1:214608224-214608246 GGCGGGCTTCCCTGGGAGGAAGG - Intronic
922338681 1:224638293-224638315 GGGGAGATTCCCAAGGGACAAGG + Intronic
922744188 1:228035125-228035147 GGAGGGCTTCCCAGGGGAGGTGG + Intronic
922806796 1:228394486-228394508 GAGGGGTCTCCCAGGGAGGACGG + Exonic
924775630 1:247113045-247113067 TGGGGGAAGCCCCGGGGGGAGGG - Intergenic
924798464 1:247309889-247309911 GGAGGGATGCCCAGCGGGCATGG + Intronic
924818191 1:247461440-247461462 GGGGGGGTTCCCTGTGGAGAAGG + Intergenic
1063461768 10:6219364-6219386 GGGAGGATTCCCTGGGGAGATGG - Intronic
1063664233 10:8051944-8051966 AGGGGGATGCCGAGGAGGGAGGG - Intergenic
1064155347 10:12898846-12898868 GGCAGGATTCACAGGGTGGAGGG - Intronic
1064409553 10:15093153-15093175 GGGGAGATTCTCAGTGGGGGCGG + Intergenic
1064619476 10:17201168-17201190 GGGGGGCTTCCCAGCTGGGGAGG - Intronic
1064635052 10:17357015-17357037 TTGGGGATTCCCTTGGGGGAAGG - Intronic
1065035895 10:21638443-21638465 GGCAGGATTCTCAGGGGGTAAGG - Intronic
1065589585 10:27251577-27251599 GGGGAGATTCCCATGGGAGATGG + Intergenic
1067438308 10:46294190-46294212 GTGAGGATTCCCAGGGTGCAGGG + Intronic
1067522908 10:47021618-47021640 GGGGGCTGTCCCTGGGGGGAAGG + Intergenic
1070800593 10:79242644-79242666 GGGAGGATTCGCTGGGGGGCGGG + Intronic
1073119574 10:101113358-101113380 GGCCAGATTCCCAAGGGGGAGGG + Intronic
1074314006 10:112345720-112345742 GGGAGAATTCCCAGGGGAAAGGG + Intergenic
1075181826 10:120218061-120218083 GGTGTGATTCCCAGGAGGCAGGG + Intergenic
1075712139 10:124536461-124536483 GGGGGCTTTCTCAGGGTGGAGGG - Intronic
1076516926 10:131051005-131051027 GGGGAGAGTCCCTGGGGGTAGGG + Intergenic
1076760927 10:132605401-132605423 GAGTGGATCCCCAGGAGGGATGG + Intronic
1077053247 11:577004-577026 GGGCGGACTCGCAGGGGGCATGG - Intronic
1077078093 11:710226-710248 AGGGGGCTTCCCTGGAGGGAGGG + Intronic
1077438845 11:2558923-2558945 GGGAGGCTTCTCAGGGTGGAGGG - Intronic
1078872513 11:15362265-15362287 GGAGGGATGCCATGGGGGGAGGG + Intergenic
1080438447 11:32268221-32268243 GTGGGGCTTCCCAGGAGAGATGG + Intergenic
1081095063 11:38921762-38921784 AGGGGGATTCCCAGGCAAGATGG - Intergenic
1081488218 11:43547781-43547803 AGGGGGCTTCCCCGGGGGGGGGG + Intergenic
1082767373 11:57180364-57180386 GGGGTGATTTCCAGGTGGGCGGG + Intergenic
1083166445 11:60891071-60891093 GGGGGGAATCTATGGGGGGAGGG - Exonic
1083735242 11:64676421-64676443 GGGTGGGTTCCCAGGGGTGGAGG - Intronic
1084938721 11:72601118-72601140 GTGGGGGTTCCCTGGGGGGATGG - Intronic
1085781780 11:79415870-79415892 GGAGGGATTATCAAGGGGGATGG - Intronic
1086174161 11:83870071-83870093 GGGAGGATTCTCAGGGGAGGTGG - Intronic
1088004741 11:104926913-104926935 GGCGGGATTCCCAGAGAGGAAGG + Intergenic
1088017191 11:105075132-105075154 GATGAGATTCCCATGGGGGATGG + Intronic
1088437373 11:109830150-109830172 GTGGGGACTCCAATGGGGGAAGG + Intergenic
1088824495 11:113482542-113482564 GGGGGTCATACCAGGGGGGAAGG + Intergenic
1088866128 11:113849777-113849799 GGGGAGATTCCCTGGTGGCAAGG + Intronic
1089393486 11:118117957-118117979 TGGGGGATCCCCAGGTGGGCAGG - Exonic
1089496767 11:118912005-118912027 GGGTGGAGTCCCGGAGGGGAGGG - Intronic
1089696478 11:120219101-120219123 TGGGGAATTCACAGGGGGGGTGG + Intronic
1092187795 12:6493825-6493847 GGAGGGATTCGCAGGCGGGCCGG + Exonic
1092743039 12:11649002-11649024 GGGGGGATTCCCGGGGAAGGTGG - Intergenic
1093101464 12:15034577-15034599 GATGAGATTCCCATGGGGGATGG - Intergenic
1094485953 12:30926406-30926428 GGGGGGATCCCTAAGGGGGGCGG - Intronic
1095597177 12:43972256-43972278 GATGAGATTCCCATGGGGGATGG - Intronic
1096052894 12:48626961-48626983 GAGTGGTTTCCCAGGGGGGTGGG + Intergenic
1096495485 12:52037220-52037242 GGGGGGCTTCCCGGGGGCGGGGG + Intronic
1096707435 12:53431152-53431174 GGGGGGAATGACAGGGAGGAAGG - Intronic
1096975174 12:55695658-55695680 AGGGGCATTCCTAGGGGGCAAGG + Intronic
1097264830 12:57738756-57738778 CGGGGGATTCGCAGGGGCGCGGG + Intronic
1099573331 12:84353331-84353353 GGGAAGATTCCCAGTGGGGTTGG - Intergenic
1101119768 12:101566507-101566529 GGGGGGTTTGCCAGGGTGGAGGG + Intergenic
1102483819 12:113242765-113242787 GGAGGTATTCACAGGGTGGATGG - Intronic
1103321402 12:120094680-120094702 GGGGGCAGTGCCAGGCGGGAGGG - Intergenic
1103876781 12:124133634-124133656 GGGTGGCTTGCCAGGGGTGAAGG + Intronic
1104267184 12:127244522-127244544 TGGGGCATTCCCAAGAGGGAAGG - Intergenic
1104730224 12:131101251-131101273 GGGGGGCTTCCCAGGGCAGTGGG + Intronic
1104812946 12:131629271-131629293 GGGGGGCTTCCCAGGGAGCAGGG - Intergenic
1104842211 12:131830558-131830580 GGGCGGCTTCCCCGCGGGGAGGG + Intronic
1105001417 12:132691709-132691731 GCAGGGATTCTCAGTGGGGAAGG - Intronic
1106243403 13:27927560-27927582 TGGGGGTTTGCCAGAGGGGAGGG - Intergenic
1106388128 13:29307861-29307883 GGGGGGATTCTCAGTGTGGAGGG - Intronic
1108850222 13:54718858-54718880 GCAGGGATTCCCAGGCAGGATGG - Intergenic
1111445832 13:88345432-88345454 GGGGGGGTGCGCGGGGGGGAGGG + Intergenic
1111522894 13:89428280-89428302 GAGGGCATTCCCCGGGGGGAAGG - Intergenic
1112191684 13:97184483-97184505 GGGGTTATTTCCAGGGGTGAGGG - Intergenic
1113617906 13:111694042-111694064 GGGGGGATCCCCAGGCAGGCTGG - Intergenic
1113623439 13:111779303-111779325 GGGGGGATCCCCAGGCAGGCTGG - Intergenic
1113700757 13:112386167-112386189 GATGGGACTCCCATGGGGGATGG - Intronic
1113818678 13:113194667-113194689 AGGGGGCTTCCCTGGGGTGAAGG - Intronic
1114632169 14:24166030-24166052 AGGGGGTCTCCCAGTGGGGAAGG + Intronic
1118571505 14:67199815-67199837 TGGGGGTATCCCAGGTGGGAGGG - Intronic
1121570696 14:94944587-94944609 TTGGGGGTTCCCAGGGAGGAGGG + Intergenic
1121635988 14:95454173-95454195 GGTTGCAGTCCCAGGGGGGATGG + Intronic
1124291723 15:28457517-28457539 GGCGGGCTTCCCTGGGAGGAAGG - Intergenic
1126085518 15:45007643-45007665 GAGGAGATTCCCATGGAGGATGG + Intergenic
1128465485 15:67907352-67907374 GGACAGATTCCCTGGGGGGAAGG + Intergenic
1128616689 15:69115831-69115853 GGGGGCCTTCCCAGAGGAGATGG - Intergenic
1128999417 15:72319990-72320012 GGGGGGCTGCCCAGGGGGCGGGG + Exonic
1129011999 15:72428495-72428517 GGGGGGAGTCGGGGGGGGGAGGG - Intergenic
1129584452 15:76848832-76848854 GTGGGGGTTCCTAGGGAGGAGGG - Intronic
1129856472 15:78828832-78828854 GGGAGGGTTCCCAGGGGAGGAGG - Intronic
1130076427 15:80694777-80694799 GGAGGGAATCCCAGGGGGAGGGG + Intronic
1130263805 15:82380607-82380629 GGGACGATTCCCAGGAGGCAGGG + Intergenic
1130831412 15:87604833-87604855 GGGGGGATCCAGAGGAGGGATGG + Intergenic
1131254721 15:90854512-90854534 GAGGGGATTCCCAGTGTGGTTGG - Intergenic
1132043778 15:98547768-98547790 GGGGGGAATGCGAGGGGGGCGGG - Intergenic
1132445406 15:101912853-101912875 GTGGGGGTTCCCAGGGGAGGGGG + Intergenic
1133030767 16:3009960-3009982 GGGGGGACTTCCAGGGAGGCAGG + Intergenic
1133275547 16:4636244-4636266 GGGGTGGTTCCCAGGGAAGAAGG - Intronic
1134861876 16:17567588-17567610 TTGGAGATTCCCTGGGGGGATGG + Intergenic
1136707060 16:32200153-32200175 GGCGGGCTTCCCTGGGAGGAAGG + Intergenic
1136760850 16:32729264-32729286 GGCGGGCTTCCCTGGGAGGAAGG - Intergenic
1136807253 16:33141122-33141144 GGCGGGCTTCCCTGGGAGGAAGG + Intergenic
1137452754 16:48592105-48592127 GATGAGATTCCCATGGGGGATGG + Intronic
1138298412 16:55906681-55906703 GAGGGGCTTCCCAGGGGAGCTGG + Intronic
1138719363 16:59061048-59061070 GTGGGGATTCCAAAGGAGGAAGG - Intergenic
1139951943 16:70676849-70676871 GGTGGGGTTCCCAGGGGTGTGGG - Intronic
1140281707 16:73560607-73560629 TGGGGAATTCCCAGGTGCGAAGG + Intergenic
1140507339 16:75482136-75482158 GGGGAGACTCCCCAGGGGGAGGG - Intronic
1141423411 16:83931315-83931337 GGGGGGTGTCCCCTGGGGGAGGG + Intronic
1141576818 16:84969417-84969439 TAGGGGATTCCCTGGGTGGAGGG - Intergenic
1142142046 16:88476804-88476826 GGAGGGCTTCCCAGAGGGGCAGG + Intronic
1203063002 16_KI270728v1_random:989578-989600 GGCGGGCTTCCCTGGGAGGAAGG - Intergenic
1143513536 17:7408215-7408237 GGGGGGGGTCCCAGGGAGGGAGG + Exonic
1143523064 17:7456523-7456545 GGGGGGTTTCCCTGGGGGTCTGG + Intronic
1143575721 17:7792109-7792131 TGGGGGATGCCCAGGGGGTCTGG - Intronic
1144892265 17:18500885-18500907 TGGAGGCTTCCCAGGTGGGAGGG - Intergenic
1145139951 17:20443403-20443425 TGGAGGCTTCCCAGGTGGGAGGG + Intergenic
1145190841 17:20841592-20841614 GGCGGGCTTCCCTGGGAGGAAGG + Intronic
1145810358 17:27760593-27760615 TGGAGGCTTCCCAGGTGGGAGGG - Intronic
1146224079 17:31050826-31050848 GAGGAGATTCCCATGGGAGATGG + Intergenic
1146341236 17:32021305-32021327 GGGGAGATTCCCATGGGAGATGG - Exonic
1147327515 17:39676566-39676588 GGGATGCTCCCCAGGGGGGAGGG - Intronic
1147764667 17:42825550-42825572 TGGGGGATTGCAAGGGGAGATGG - Intronic
1147922580 17:43927165-43927187 GGGGAGATTCCCACGGGAGATGG + Intergenic
1147927370 17:43953986-43954008 AGGGGGAGTCCCAGGGGGAGGGG + Intronic
1147957170 17:44142374-44142396 GGGGGGTTTCCCAGGAGGGTAGG - Intronic
1148246891 17:46038130-46038152 GGGGAGATTCCCATGGGCGTTGG - Intronic
1148542479 17:48491792-48491814 GGGGGAATTCCCAGAAGTGAGGG + Intergenic
1148737549 17:49873292-49873314 GGTGGGATGCTGAGGGGGGAGGG + Intergenic
1148967266 17:51446665-51446687 AGGGGGATTCCCAGGCCAGATGG + Intergenic
1149007392 17:51820189-51820211 GGGGGTATTACCTGGGGGGGGGG - Intronic
1150634334 17:66902357-66902379 TGGGAGTTTCCCAGGTGGGAGGG + Intergenic
1150784585 17:68152253-68152275 GGGGAGATTCCCATGGGAGATGG + Intergenic
1151285416 17:73107594-73107616 GTGGGCCTTCCCAGGGAGGAGGG + Intergenic
1152459467 17:80433583-80433605 GGGGAGCTTCCCAGGGGGCCGGG + Intronic
1152580571 17:81163955-81163977 GGGGGGGCACCCAGAGGGGAGGG - Intronic
1152915329 17:83031713-83031735 GGGGTGGGTCCCAGGGAGGATGG + Intronic
1153911421 18:9708809-9708831 GCGGGGACCCCCAGCGGGGACGG + Intronic
1154015142 18:10609485-10609507 GAGGGGTTTCCCAGCTGGGAGGG - Intergenic
1154121698 18:11657619-11657641 GGGGGGGCTCCCAGGGGCAAAGG - Intergenic
1154190379 18:12226159-12226181 GGGGGGTTTCCCAGCTGGGAAGG + Intergenic
1156452590 18:37275074-37275096 GGAGGGATGCCCCGGAGGGAGGG - Intronic
1156492665 18:37505572-37505594 GGGAGGATTCCCCTGGGAGAAGG - Intronic
1157813697 18:50716347-50716369 GGGGGGATTGCCAGAGAGGGAGG - Intronic
1158541080 18:58355081-58355103 AGGGGATTTCCCAGAGGGGAGGG + Intronic
1159943354 18:74425826-74425848 AGGGGTATTCCCGGGGAGGAGGG - Intergenic
1159968601 18:74621551-74621573 GTGGGGAGGCCCATGGGGGAAGG - Intronic
1160054423 18:75465527-75465549 GGGAGGGGGCCCAGGGGGGAAGG + Intergenic
1160639902 19:120854-120876 GTGGGGGTTCCCAGGGGAGGGGG - Intergenic
1160995363 19:1879831-1879853 GGCGGGCTTCCCTGGGAGGAAGG - Intronic
1161988351 19:7669939-7669961 GGGGGCATTCCCAGGGGACTTGG - Intronic
1162837808 19:13332823-13332845 GGGGTGGGTCCCAGGGGAGAAGG - Intronic
1163463820 19:17455063-17455085 GGGGGGGTTGCCAAGGCGGAGGG - Intronic
1163501687 19:17680084-17680106 GAGGGGGTTCTCAGGAGGGAAGG + Intronic
1163764878 19:19157946-19157968 GGGGGAAGTCCCAGGGGCTAGGG + Intronic
1164598626 19:29546654-29546676 TGGGGGCTCCCCAGCGGGGACGG - Intronic
1165070191 19:33251214-33251236 CAGGGGATTCCCGGGGGGCAGGG + Intergenic
1165177300 19:33939510-33939532 GGGGTGCTTCCCAGGGTGGGTGG - Intergenic
1165612653 19:37169810-37169832 AGGAGGAGTCCCAGGGGGGTGGG - Intronic
1166090333 19:40504157-40504179 GGGTGGAGTGCCAGGAGGGAGGG + Intronic
1167250014 19:48394582-48394604 GGGGGGATCCCCACGGGGTCGGG + Intergenic
925014207 2:509535-509557 GAGGGGATGCCCAGGGTGGCAGG + Intergenic
925966153 2:9068294-9068316 AGGGGGATTCTAAGGGGAGAGGG - Intergenic
926164380 2:10510494-10510516 GGGTAGTTTCCCAGGGGGGTGGG - Intergenic
926220858 2:10934703-10934725 GGGGGCTTTCCCAGGGATGAGGG - Intergenic
926251317 2:11156783-11156805 GGGGGGGGTCCCAGGCTGGATGG + Intronic
929303828 2:40336581-40336603 TGGAGGATTCCCAGGGGAAAAGG - Intronic
930108528 2:47658553-47658575 TTGGGGATTCCCAGAAGGGAAGG + Intergenic
933790384 2:85879347-85879369 GAGGGGAGTCGCAGGGGAGAAGG + Intronic
934568590 2:95354132-95354154 GGGAGAGTTCCCAGGGGAGATGG - Intronic
936451232 2:112635387-112635409 GGGAGGTTCCCCAGTGGGGAAGG + Intergenic
938453970 2:131445937-131445959 GGGGGGCTTCCCGGAGGAGAAGG + Intergenic
940815623 2:158294060-158294082 GGAGGGATTTCCAAGGCGGAAGG - Intronic
941126455 2:161590165-161590187 GGGGGGGTGGGCAGGGGGGAGGG - Intronic
943112452 2:183622400-183622422 AGGGGGATTCCCAGGCAAGATGG - Intergenic
943985024 2:194607175-194607197 GAGGAGACTCCCACGGGGGATGG + Intergenic
944831444 2:203536924-203536946 GGGGGGATGGAGAGGGGGGAGGG + Intergenic
946056814 2:216910000-216910022 GTGGGGACTCCCAGCAGGGATGG - Intergenic
946200578 2:218068685-218068707 GGTGGGTTTCCCAGGTGGGCTGG - Intronic
946368653 2:219266745-219266767 GGGGGGCATCACAGGGGGTAGGG + Intronic
947475762 2:230446485-230446507 TGGGGAATTCCCTGGGGAGAAGG - Intronic
948353418 2:237359361-237359383 TCGGGGATTCCCAGGAGAGAAGG - Exonic
948355426 2:237373688-237373710 GGGGGGGTTCACAGTGGCGAAGG - Intronic
948856169 2:240731719-240731741 GGGGGTCTTCCCAGTGGGGAGGG - Intronic
1168800598 20:641940-641962 GGGGGGAGGCCCAGCGGGGGTGG + Intergenic
1168800615 20:641974-641996 GGGGGGAGGCCCAGCGGGGGTGG + Intergenic
1168800631 20:642007-642029 GGGGGGGTGCCCAGCGGGGGTGG + Intergenic
1168800660 20:642070-642092 GGGGGGAGGCCCAGCGGGGGTGG + Intergenic
1168800693 20:642133-642155 GGGGGGAGGCCCAGCGGGGGTGG + Intergenic
1168800710 20:642167-642189 GGGGGGAGGCCCAGCGGGGGTGG + Intergenic
1168800726 20:642200-642222 GGGGGGGTGCCCAGCGGGGGTGG + Intergenic
1168910573 20:1443676-1443698 GGGGCGATCCCCATGGGGCATGG + Exonic
1168965426 20:1895326-1895348 GGGGGGAGGCCCAGCCGGGAGGG + Intronic
1169075468 20:2757376-2757398 GAGGGGGTTCCCTGGTGGGAAGG - Intronic
1170431831 20:16283241-16283263 GGTGGGCTACCCAGGGTGGAAGG + Intronic
1170999181 20:21396537-21396559 GGGAAGAGTCCCAAGGGGGAAGG + Intronic
1171310786 20:24143183-24143205 TGGGGGAGTGCCAGGGAGGAGGG - Intergenic
1171377084 20:24700822-24700844 GGGGAGGGTCCCAGGGAGGACGG - Intergenic
1172271652 20:33658681-33658703 GGTGGGATGGCCAGTGGGGAGGG - Intronic
1173422996 20:42919152-42919174 TGGGGGATCCCCAGGCTGGAGGG - Intronic
1175858056 20:62133380-62133402 GGGCGGATTCCGAGGAGGCAGGG + Exonic
1175887742 20:62302277-62302299 GGAGGGGTTCCCGGAGGGGAGGG - Intronic
1175948318 20:62569006-62569028 GGGGGGCTTTCCAGAGGAGATGG - Intronic
1175992393 20:62796348-62796370 GGGCGGAGTCCCCGGCGGGAAGG + Intergenic
1176093525 20:63329358-63329380 GGGGGCATGGCCAGGTGGGAAGG - Intronic
1176549441 21:8214879-8214901 CGGGGGATTCCCCGCGGGGGTGG - Intergenic
1176557336 21:8259108-8259130 CGGGGGATTCCCCGCGGGGGTGG - Intergenic
1176568369 21:8397913-8397935 CGGGGGATTCCCCGCGGGGGTGG - Intergenic
1176576278 21:8442143-8442165 CGGGGGATTCCCCGCGGGGGTGG - Intergenic
1179178933 21:39028952-39028974 GGGCGGGTGCCCAGGGGAGAAGG - Intergenic
1179416016 21:41199333-41199355 GGAGGGAGCCCCAGGGAGGAGGG + Intronic
1179932263 21:44578761-44578783 TGGGGGATTTTCTGGGGGGATGG - Intronic
1182335397 22:29580560-29580582 TGGGGGATCCCCAGGGGCCATGG - Intronic
1182354636 22:29717099-29717121 GGGGGGTTCCCCAAGTGGGAAGG - Intergenic
1182741404 22:32570563-32570585 GGGAGGAGTCTCAGGAGGGAGGG + Intronic
1183249028 22:36715453-36715475 GGAGGGATTCCCACGGGTGGTGG - Intergenic
1183329443 22:37211700-37211722 GTGGGGACTCCCAGGGAGGCAGG - Intronic
1183912651 22:41091480-41091502 GGGAGGATTTTAAGGGGGGAGGG - Intergenic
1184059972 22:42075446-42075468 GGGGGGATTCTCAGGGGTCAGGG + Intronic
1184478041 22:44732006-44732028 TGGGGGATTCACAGGGAGGGAGG - Intronic
1184888704 22:47366474-47366496 TGGGGGAGTCCCAGGGGGACAGG + Intergenic
1185332218 22:50256882-50256904 GGGGGGATTGCACTGGGGGAGGG + Intronic
1185346548 22:50313100-50313122 GGGGGGAGTCTGAGAGGGGATGG + Exonic
1203254328 22_KI270733v1_random:131201-131223 CGGGGGATTCCCCGCGGGGGTGG - Intergenic
1203262384 22_KI270733v1_random:176280-176302 CGGGGGATTCCCCGCGGGGGTGG - Intergenic
950467270 3:13162884-13162906 GGGGGGGATGCCCGGGGGGATGG - Intergenic
950480182 3:13239055-13239077 GGGGAGATTCACAGGGAGCAGGG - Intergenic
952650900 3:35725583-35725605 GGGAACATTCCCAGGGAGGAAGG - Intronic
953013720 3:39052448-39052470 CAGGGGTTTCCCAGGGGGGTGGG + Intronic
954372039 3:50174123-50174145 GGTGGGATCCACAGGTGGGAAGG + Intronic
954372047 3:50174144-50174166 GGGGGAATCCACAGGTGGGAAGG + Intronic
955204972 3:56887609-56887631 GGGGGCGTTCCCAGGCAGGAAGG + Intronic
955339425 3:58113576-58113598 GGAGGGATTCCCTGGGCGAAGGG + Intronic
955407831 3:58636479-58636501 GGTGGGATTCCCATGGGGCAAGG + Intronic
955800935 3:62685691-62685713 GGGGGGATTGGTTGGGGGGATGG + Intronic
958004431 3:87793311-87793333 GAGAGGATTCGCGGGGGGGACGG + Intergenic
961126593 3:124424155-124424177 GGGGGGGTTCCCAGCAGGGCAGG + Intronic
961315582 3:126033170-126033192 GGGAGGATTTCCAGGCAGGAAGG + Intronic
961788201 3:129360068-129360090 GGGGACATTCCTAGGGGAGAAGG - Intergenic
962374195 3:134846749-134846771 GGTGGGATGCTCAGGTGGGATGG + Intronic
962374708 3:134850459-134850481 GAGAGAATTCCCAGGGGGCAAGG - Intronic
963115395 3:141724655-141724677 GGGGGGATTCTCAGTGTGGTGGG - Intergenic
965603166 3:170474451-170474473 GGTGGGATTCCAAGGAGGGAGGG - Intronic
965803029 3:172513709-172513731 GGGGGAATTCCCAGGGTAGGAGG - Intronic
966768972 3:183486963-183486985 CTGGGGATGCCCAGAGGGGAAGG + Intergenic
967732339 3:192917898-192917920 GGGAGGAGGCCCAGGGGGGCGGG - Exonic
968446653 4:655533-655555 GGAGGGGTTCCCAAGAGGGAGGG + Intronic
968693409 4:2008452-2008474 TGGGGGATTCCCAGGGGGCGAGG + Intronic
968982056 4:3855634-3855656 GGAGGGCCTGCCAGGGGGGAGGG - Intergenic
969285679 4:6200594-6200616 GGAGGGGCTCCCCGGGGGGAGGG - Intergenic
969568295 4:7992995-7993017 GGGGGGCTTCCCACCGGGGTGGG + Intronic
974109628 4:57511317-57511339 GTGGGGGTTCCCAGGGAAGAGGG + Intergenic
974535360 4:63167417-63167439 GAGGGAATTCCCAGGGGAAAGGG - Intergenic
976792020 4:88889052-88889074 GAGGGGAATCGCAGGGGTGAAGG + Intronic
977177974 4:93838799-93838821 GGGGGGGGTGCAAGGGGGGATGG + Intergenic
977293980 4:95191979-95192001 AGGAGGATTAGCAGGGGGGAGGG - Intronic
985760732 5:1747281-1747303 GGTGGCATTCCCAGGCAGGAGGG + Intergenic
985890888 5:2714626-2714648 GGTGGGAGACCCATGGGGGAAGG + Intergenic
986274082 5:6258276-6258298 GCTGGGATTCCCTGGGGAGAGGG - Intergenic
986574315 5:9196727-9196749 GGTGGGATTCCCTGTTGGGAAGG - Intronic
988473482 5:31562869-31562891 GGTGGGCTTCCCAGGGTGGCTGG - Intergenic
990919207 5:60944712-60944734 GGGGGGGTTCCCCGGGGGTGGGG - Intronic
992169422 5:74087226-74087248 GGAGGGATGACCAGAGGGGAGGG - Intergenic
993413741 5:87601234-87601256 GTGGGGGTTCCCAGGGAAGAGGG + Intergenic
996045941 5:118873626-118873648 GTGGGGATTGGCAGGGGCGATGG - Intronic
996329230 5:122311631-122311653 GGGGCGATTTCCAGGGGGAGAGG + Intronic
997973993 5:138428050-138428072 GTTGGGATTCCCATCGGGGAGGG + Exonic
999156956 5:149464901-149464923 GGGCTGATTCCCAGGGGTGAGGG - Intergenic
1001555269 5:172632713-172632735 GGGGGGATCCCAAGTTGGGAAGG - Intergenic
1002747252 6:69261-69283 GTGGGGGTTCCCAGGGGAGGGGG - Intergenic
1002759330 6:189814-189836 AGGGGGCTGCCCAGGGGGAAAGG - Intergenic
1005959053 6:30683602-30683624 GAGGGGAAACCCAGGGAGGAAGG + Intronic
1006395029 6:33781753-33781775 TGAGGGCTTCCCAGGGGAGATGG - Intronic
1007167919 6:39841372-39841394 GGGGAGGGTTCCAGGGGGGAGGG + Intronic
1008220127 6:48844825-48844847 GTGGGGGTTCCCAGGGTAGAGGG + Intergenic
1012597231 6:101054596-101054618 TGGGGGATTCCCAGGCAAGATGG - Intergenic
1017264486 6:152426630-152426652 TGGGGTATTCCCAGAGGGGAGGG - Intronic
1017435516 6:154412159-154412181 TGTGGTATTCCCAGGTGGGATGG + Intronic
1017504847 6:155058946-155058968 GGAGGGCTTCCCAGAGGAGAAGG + Intronic
1017720693 6:157241137-157241159 GGGAGGCTTCCAAGGTGGGATGG + Intergenic
1018368979 6:163149924-163149946 GTGGGGAGTCCCAGGGCGGGAGG - Intronic
1018732801 6:166665475-166665497 GGGGGTCTTCTCAGAGGGGAGGG - Intronic
1018905150 6:168071709-168071731 GAGGGAGTTCCCAGGTGGGAGGG - Intronic
1018986851 6:168644234-168644256 GGGGAAATTCCCAGGGCGGAGGG - Intronic
1019331514 7:462895-462917 TGGGGGCTTCCCGGGGGGGAGGG + Intergenic
1019499758 7:1358996-1359018 GGAGGGGTTCCCAGAGGGGTGGG + Intergenic
1019538039 7:1538969-1538991 GAGGGGCTTCCCAGGGGGTGAGG - Intronic
1019914224 7:4122175-4122197 GGGGAGATTCCCAGAGAAGAAGG - Intronic
1024006500 7:45228220-45228242 TGGAGGAGGCCCAGGGGGGATGG + Intergenic
1024045511 7:45582835-45582857 TGGGGGAATCCCTGGGGGCAGGG + Intronic
1026282576 7:68934673-68934695 GGAGGGCTTCCCAGAGGAGAGGG + Intergenic
1026841308 7:73671259-73671281 GGCGGGAGTCCAAGGGGGGCAGG - Exonic
1026900212 7:74032804-74032826 AGGGGGACTCCCAGGGCAGATGG + Intronic
1028616411 7:92772718-92772740 GGGGGGAATCTCAAGGGTGAGGG - Intronic
1029514663 7:101017808-101017830 GAAGGGAGTCCCAGGGGGAAGGG - Intronic
1029514683 7:101017849-101017871 GGAGGGAGTCCCAGGGGGAAAGG - Intronic
1029514703 7:101017890-101017912 GGAGGGAGTCCCAGGGGGAAGGG - Intronic
1029514724 7:101017931-101017953 GGAGGGAATCCCAGGGGGAAGGG - Intronic
1029514745 7:101017972-101017994 GGAGGGAGTCCCAGGGGGAAGGG - Intronic
1029514766 7:101018013-101018035 GGAGGGAGTCCCAGGGGGAAGGG - Intronic
1029514787 7:101018054-101018076 GGAGGGAGTCCCAGGGGGAAGGG - Intronic
1029514830 7:101018136-101018158 GGAGGGAGTCCCAGGGGGAAGGG - Intronic
1029514852 7:101018178-101018200 GGAGGGAGTCCCAGGGGGAAGGG - Intronic
1029514950 7:101018409-101018431 GGGGGGAGTCCCAGGGGAAGGGG - Intronic
1033286872 7:140049111-140049133 GGGGGAAGTCCCATGGAGGAGGG + Intronic
1033471580 7:141654690-141654712 GGGAGGATTGCGAGGGGGAAGGG + Exonic
1035064716 7:156096256-156096278 GGAGGGGTGCCCAGGTGGGATGG - Intergenic
1035266442 7:157692435-157692457 GGGGCGAGCCCCAGGGGGCAGGG + Intronic
1035369263 7:158368664-158368686 GGGGGGCTCCCCAGGGAGGAAGG + Intronic
1035746898 8:1967484-1967506 GTGGGGGTGCCCAGGGAGGAGGG - Intergenic
1035863279 8:3053534-3053556 GGGAAGATTCCCAGGGCAGAAGG + Intronic
1036687373 8:10920988-10921010 GAGGGGCTTCCCTGGGGTGAAGG + Intronic
1038452831 8:27650855-27650877 GAGGGGATTCCCAGGGTGTGGGG + Intronic
1038480925 8:27901442-27901464 GTGGGGCTTCCCAGGGCGCAGGG + Intronic
1042043797 8:64624901-64624923 GTGGGGGTACCCAGGGGGAAGGG - Intronic
1042719397 8:71810892-71810914 GGTGGGGTTGCCAGGGGGGTGGG + Intergenic
1044697403 8:94936942-94936964 GGGCAGATTCCCTGGTGGGAAGG + Intronic
1045258485 8:100550616-100550638 GGGGAGATTCCCAGTGTGGTGGG + Intronic
1047436990 8:124843038-124843060 GGGTGGACTGCCAGGGGAGATGG - Intergenic
1047499266 8:125429729-125429751 GGGGGGATCCCCGGGGCGAAAGG + Intergenic
1048302920 8:133264834-133264856 GAGGGGACTCCCAGGAGGCAGGG + Intronic
1048517381 8:135123305-135123327 GGGGGGATTCCTAGAAGGGAGGG + Intergenic
1049355042 8:142183364-142183386 AGGGGGGCTCCCAGGGGAGAGGG - Intergenic
1049362486 8:142219009-142219031 GGAGGAATCCCCAGGGGTGAAGG - Intronic
1049473162 8:142785198-142785220 AGGGGCCTTCCCTGGGGGGAAGG + Exonic
1049707332 8:144049010-144049032 GCGGGGAGTCACAGGGGTGAAGG - Intergenic
1051173042 9:14338848-14338870 GAGGGGGATCCAAGGGGGGAAGG - Intronic
1051513877 9:17907537-17907559 GGGAGGATTCGGAGGGGGTATGG - Intergenic
1051596119 9:18825938-18825960 GGGGGGCTTGCCAAGGTGGAAGG - Intronic
1051726142 9:20089531-20089553 GTGGGGGTTCCCAGGGAAGAGGG - Intergenic
1052057795 9:23923358-23923380 GGGGGGATTCATACTGGGGACGG + Intergenic
1053179905 9:35960010-35960032 GGGGGGGTTGGCGGGGGGGACGG + Intergenic
1055295277 9:74827192-74827214 GGGGAGATACCCATGTGGGAAGG - Intronic
1055295350 9:74827622-74827644 GGGGAGATGCCCATGTGGGAAGG + Intronic
1057279049 9:93697491-93697513 GGAGGGATTCCTAGGGGAGAAGG - Intergenic
1059332803 9:113546756-113546778 TGGGGAATTCCCAGAGGGAAAGG + Intronic
1060124010 9:121024254-121024276 GGGGGGAGTGGGAGGGGGGAGGG + Intronic
1061296063 9:129677463-129677485 TGGGGGAGGCCCAGGAGGGATGG + Intronic
1061923433 9:133794605-133794627 GGGGGGCTGCCCAGAGGGCAGGG + Intronic
1062046870 9:134428464-134428486 CGGGGGGTTCCCTGGGGGGTGGG - Intronic
1062046920 9:134428612-134428634 GGGGGGATTCCCAGGGGGGAAGG - Intronic
1203470729 Un_GL000220v1:114345-114367 CGGGGGATTCCCCGCGGGGGTGG - Intergenic
1203478550 Un_GL000220v1:158317-158339 CGGGGGATTCCCCGCGGGGGTGG - Intergenic
1186834874 X:13427773-13427795 AAGGGCATTCCCAGGGGAGAGGG - Intergenic
1187573331 X:20528337-20528359 GCAAGGATTCCCAGTGGGGAAGG + Intergenic
1188199096 X:27277742-27277764 GGGTAGATTCCCTGGTGGGAGGG + Intergenic
1189632833 X:42973642-42973664 GGGGTGATTCACACGGGGGCTGG - Intergenic
1191123062 X:56926042-56926064 GTGGGGGTTCCCAGGGTAGAGGG + Intergenic
1192169000 X:68842969-68842991 GGGGGGACTCCCTGTGGAGACGG + Intergenic
1192181261 X:68917148-68917170 AGCGGGAATCCCAGGAGGGATGG + Intergenic
1194102147 X:89718861-89718883 GGGGGGATTGTCAGGGGTTAGGG - Intergenic
1197720559 X:129742171-129742193 GGGGGCACTCACAGGGGGGTTGG - Exonic
1198642368 X:138770505-138770527 GGAGGGATTCTCAGAGGGGTTGG - Intronic
1200042712 X:153381339-153381361 TGGAGGAGTCCCAGGGGAGACGG + Intergenic