ID: 1062046921

View in Genome Browser
Species Human (GRCh38)
Location 9:134428616-134428638
Sequence TTTCGGGGGGATTCCCAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062046921_1062046936 28 Left 1062046921 9:134428616-134428638 CCCCCCTGGGAATCCCCCCGAAA 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046921_1062046933 12 Left 1062046921 9:134428616-134428638 CCCCCCTGGGAATCCCCCCGAAA 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062046921 Original CRISPR TTTCGGGGGGATTCCCAGGG GGG (reversed) Intronic
900505665 1:3028843-3028865 TTTCCTGGGGACCCCCAGGGAGG - Intergenic
901312838 1:8282692-8282714 CTTTGGTGAGATTCCCAGGGTGG - Intergenic
903202631 1:21754855-21754877 TCTAGTAGGGATTCCCAGGGAGG + Intronic
904461610 1:30684031-30684053 GTGCAGGAGGATTCCCAGGGGGG + Intergenic
904604789 1:31692435-31692457 TGGAGGGGGGATTTCCAGGGAGG - Intronic
912908220 1:113729886-113729908 CTTCGGGGAGCTTCCCTGGGTGG + Intronic
916294743 1:163205441-163205463 TTTCTGAGGGATTCTCAGGAGGG - Intronic
924300484 1:242632820-242632842 TTCCCCGGGGATTCCCAAGGAGG - Intergenic
924778318 1:247126542-247126564 GTACTGGGGGATTCGCAGGGAGG + Intronic
924783340 1:247171878-247171900 GTACTGGGGGATTCGCAGGGAGG - Exonic
1062946877 10:1468254-1468276 TTTGGGAGGGAGGCCCAGGGTGG + Intronic
1070321644 10:75359018-75359040 TTTCGGGAGGATTCCAAGTGAGG + Intergenic
1074963666 10:118470069-118470091 TATAGGAGTGATTCCCAGGGTGG - Intergenic
1077259430 11:1608027-1608049 TTTCGTGGGGGCTCCAAGGGGGG - Exonic
1077703973 11:4466655-4466677 TTTCTGAGGGTTTCCCAGGTAGG - Intergenic
1083197286 11:61096109-61096131 TTTCGGGGGAATTCCCATAATGG - Intergenic
1090407975 11:126488776-126488798 TTTTGGGGGGATCCCCTGTGGGG - Intronic
1091688578 12:2580733-2580755 TTTCAGTGGGATTCCTGGGGAGG - Intronic
1096783019 12:54001614-54001636 TGTCTGGGGGAGTCCCAGGAGGG + Intronic
1097386346 12:58954087-58954109 ATGACGGGGGATTCCCAGGGTGG + Intergenic
1100449892 12:94695930-94695952 TTTCCTGGGCATGCCCAGGGTGG + Intergenic
1101816782 12:108151666-108151688 ATTCCGGGAGATTCCCAGGAGGG - Intronic
1104637421 12:130447002-130447024 TTTCAGGGGGATCTGCAGGGGGG + Intronic
1106773038 13:32981209-32981231 TTACCTGGGGATTCCAAGGGAGG + Intergenic
1107281608 13:38742672-38742694 TTTTGTGGGGCTTCCCAGTGAGG + Intronic
1110791793 13:79593754-79593776 ATTCAGCTGGATTCCCAGGGAGG - Intergenic
1123476610 15:20595785-20595807 CTAAGGGGGAATTCCCAGGGAGG - Intergenic
1123641401 15:22404579-22404601 CTAAGGGGGAATTCCCAGGGAGG + Intergenic
1123702781 15:22928095-22928117 TTTGGGGTGGATTCTCATGGTGG - Intronic
1134402662 16:13924258-13924280 GTTAGCAGGGATTCCCAGGGTGG - Intronic
1135966237 16:27037466-27037488 TTTCCCCGGGGTTCCCAGGGTGG - Intergenic
1139990753 16:70937990-70938012 TTTCTGTGTGGTTCCCAGGGAGG + Intronic
1143046646 17:4086294-4086316 TTTCTGGGGGATTCCCACAGCGG + Intronic
1143046655 17:4086324-4086346 TTTCTGGGGGATTCCCACAGCGG + Intronic
1143046664 17:4086354-4086376 TTTCTGGGGGATTCCCACAGCGG + Intronic
1143250787 17:5521647-5521669 TTTCAGGAGGACTCCCAAGGGGG + Exonic
1144462635 17:15470123-15470145 TTTCAGGGGGATTCTCAGGTGGG - Intronic
1148024963 17:44580665-44580687 TTTAGAGGGCATTCCCAGGTAGG - Intergenic
1150442995 17:65206726-65206748 TTTTTAGGGGATGCCCAGGGAGG + Intronic
1152030274 17:77837996-77838018 CTTCGGGGGTATCACCAGGGTGG + Intergenic
1154303314 18:13213412-13213434 CTTCGGGGGGAGGCCCAGTGGGG + Intergenic
1157570650 18:48710030-48710052 TTTTGGGGAGCTTCCCAGAGAGG - Intronic
1160859144 19:1230389-1230411 TTCCTGGGGGCTTCCAAGGGAGG - Exonic
1163098145 19:15075780-15075802 TATAGGGTGGATTCCCAGTGTGG - Intergenic
1164048311 19:21562086-21562108 TTTTGGGGGGAGACCCAGGCTGG - Intergenic
1167796161 19:51710484-51710506 TTTCACGGGGATTAGCAGGGAGG + Intergenic
925135465 2:1523133-1523155 TTTTGGGAGGATGCACAGGGTGG - Intronic
927865655 2:26585755-26585777 GTTCGGGGAGAAACCCAGGGTGG - Intronic
935359863 2:102238123-102238145 GTCCCTGGGGATTCCCAGGGGGG - Intronic
936980616 2:118261993-118262015 TTTCTGGAGGATTCCCATGAAGG + Intergenic
938072244 2:128314857-128314879 TTTCAGGGACATTTCCAGGGTGG + Intronic
943062130 2:183050134-183050156 TTTCGGGGGGAAGTGCAGGGAGG + Intergenic
947727755 2:232410358-232410380 TGTGGTGGGGATCCCCAGGGGGG + Exonic
947752132 2:232538720-232538742 AGTGGGGGGGATGCCCAGGGAGG + Intergenic
1173422998 20:42919156-42919178 TCTCTGGGGGATCCCCAGGCTGG - Intronic
1176415860 21:6474447-6474469 GTTGAGGGGGAGTCCCAGGGGGG + Intergenic
1177207712 21:18029651-18029673 TTTTGGGGGGAATCTCAGGGAGG + Intronic
1179691360 21:43082781-43082803 GTTGAGGGGGAGTCCCAGGGGGG + Intergenic
1179957844 21:44751164-44751186 TTTCTGGTGAATTCCAAGGGAGG - Intergenic
1180647029 22:17347790-17347812 CTTCGGGAGGCTCCCCAGGGAGG - Intergenic
1181287342 22:21763343-21763365 TTTCTGGGGATGTCCCAGGGTGG - Exonic
1184478043 22:44732010-44732032 CTGCTGGGGGATTCACAGGGAGG - Intronic
950182025 3:10920182-10920204 TTTGGAGGGGAGTCCCAGAGAGG + Intronic
953078721 3:39595369-39595391 TTTCGGGGGGATTCAATGGCTGG + Intergenic
954419636 3:50411947-50411969 TTGTGGGGGGATTTCCAGGATGG - Intronic
957598782 3:82305378-82305400 TTCTGGGGGGATTGGCAGGGCGG - Intergenic
960877027 3:122307299-122307321 TTTCTGGGGGCTTCCCAGTTGGG - Intergenic
961506763 3:127375279-127375301 TTTCTGGGGCATACCCAGGCCGG + Intergenic
961665555 3:128491548-128491570 CTCCGGGGGGGTTCCCAAGGGGG + Intronic
962380191 3:134892390-134892412 TTTCTGAGGGATTCCCAGGCTGG + Intronic
962889440 3:139658216-139658238 TATCTTGGGGAGTCCCAGGGTGG - Intronic
963115397 3:141724659-141724681 TTCAGGGGGGATTCTCAGTGTGG - Intergenic
967887397 3:194342405-194342427 CTTCGGGGGGCTGCCCAGGCTGG - Exonic
979324184 4:119360259-119360281 TTTGGGAGGGATGCCAAGGGAGG + Intergenic
983242023 4:165244959-165244981 TTTGGGAGGGATGCCAAGGGAGG + Intronic
983892223 4:173041799-173041821 TTTAGTGGGCATCCCCAGGGAGG - Intergenic
986425265 5:7624768-7624790 TTTTGGGGAGATTCTTAGGGAGG + Intronic
987059437 5:14228015-14228037 TTTTGGGGGGATTCAGAGGGAGG + Intronic
988018650 5:25595136-25595158 TTTCCGATGGATTACCAGGGAGG - Intergenic
994754172 5:103774599-103774621 TTTCAGGTGGATCCCCCGGGCGG + Intergenic
999405680 5:151304625-151304647 TTTAGGGTGGTTTCCCAGGCTGG - Intergenic
1002714152 5:181215938-181215960 TTTCGGGAGGATCCTCCGGGAGG - Intergenic
1016244120 6:141962836-141962858 TAAAGGTGGGATTCCCAGGGAGG - Intergenic
1018286435 6:162244236-162244258 TTTTGATGGAATTCCCAGGGAGG + Intronic
1018781789 6:167074885-167074907 TTTCTGGGGGAGTGCTAGGGTGG + Intergenic
1022826746 7:34022338-34022360 CTTTGGGGGAATTCCCAGTGAGG + Intronic
1035225428 7:157429846-157429868 TTTCTGGGGGAGTCCCATGAGGG - Intergenic
1037242732 8:16795789-16795811 TTTCTGGGGGAGTCAGAGGGGGG + Intergenic
1061071204 9:128311709-128311731 TTTTGGAGGGATCCCCATGGCGG + Intronic
1061397140 9:130349402-130349424 TTTTGGGGGGCTTCCCAGGAAGG + Intronic
1062046921 9:134428616-134428638 TTTCGGGGGGATTCCCAGGGGGG - Intronic
1062612297 9:137380553-137380575 ATTGGGGGGGATGCCCAGAGGGG - Intronic
1062612348 9:137380660-137380682 ATTGGGGGGGATGCCCAGAGGGG - Intronic
1187719715 X:22138162-22138184 TTTCTGGGGGATTCCCAACTAGG + Intronic
1189662605 X:43318015-43318037 TCTCAGAGGGATTCCCAGTGGGG + Intergenic
1195583156 X:106531761-106531783 TTTTGGGGAAATTCCCAGTGGGG + Intergenic
1197630447 X:128852376-128852398 ATTCTGGGGCACTCCCAGGGAGG + Intergenic
1199592751 X:149483021-149483043 GTTCACGGGGATTACCAGGGAGG + Exonic