ID: 1062046922

View in Genome Browser
Species Human (GRCh38)
Location 9:134428617-134428639
Sequence CTTTCGGGGGGATTCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062046922_1062046933 11 Left 1062046922 9:134428617-134428639 CCCCCTGGGAATCCCCCCGAAAG 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046922_1062046936 27 Left 1062046922 9:134428617-134428639 CCCCCTGGGAATCCCCCCGAAAG 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046922_1062046937 30 Left 1062046922 9:134428617-134428639 CCCCCTGGGAATCCCCCCGAAAG 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1062046937 9:134428670-134428692 TTGGATAACCTGCTGTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062046922 Original CRISPR CTTTCGGGGGGATTCCCAGG GGG (reversed) Intronic
900523174 1:3115969-3115991 CTCCCGGGAGGACTCCCAGGCGG + Intronic
900713345 1:4128838-4128860 CTTTGGGTGGGTTCCCCAGGAGG - Intergenic
903269457 1:22178426-22178448 CTTTCAGGGGGCTGCACAGGAGG - Intergenic
904044386 1:27601391-27601413 CTTTGGGGCAGATGCCCAGGTGG - Intronic
909627114 1:77729859-77729881 ATTTCGGGGGTATTCTCAGCAGG - Exonic
916294744 1:163205442-163205464 ATTTCTGAGGGATTCTCAGGAGG - Intronic
920850394 1:209624422-209624444 CCTTCGGGGGGATGACCAGCTGG - Intronic
923634322 1:235680507-235680529 CTTTGGGAGGCCTTCCCAGGTGG - Intronic
924013346 1:239691851-239691873 CTTTAGGGGGGATTCTCAAATGG - Intronic
1062952858 10:1517836-1517858 CTATCCTGGGGATTCACAGGAGG - Intronic
1072611426 10:97019745-97019767 CTTACGGGTGGTGTCCCAGGCGG - Intronic
1075619107 10:123912578-123912600 CTTTGGGGTGAATACCCAGGAGG - Intronic
1077814716 11:5675544-5675566 GATTCTGGGGCATTCCCAGGAGG - Intronic
1080681673 11:34482622-34482644 CTTTGGGGGTGATTACTAGGTGG + Intronic
1083743926 11:64724834-64724856 CTTTGGTGGGGATGCCCTGGGGG - Intergenic
1088818004 11:113434515-113434537 CTTGCAGGGTGTTTCCCAGGTGG + Intronic
1096783018 12:54001613-54001635 GTGTCTGGGGGAGTCCCAGGAGG + Intronic
1101816783 12:108151667-108151689 CATTCCGGGAGATTCCCAGGAGG - Intronic
1108179584 13:47827530-47827552 CTTTGGAGCTGATTCCCAGGTGG - Intergenic
1113362870 13:109647240-109647262 AACTCGGGGGTATTCCCAGGAGG + Intergenic
1113936931 13:113999743-113999765 CTGCCGGGGGGTCTCCCAGGGGG + Intronic
1114410893 14:22499349-22499371 CTCTCGGGGGGAATCCTAGATGG + Intergenic
1117204117 14:53423792-53423814 CTTTTGGGGGCATTCCAAGATGG + Intergenic
1118747379 14:68784215-68784237 CTTTCTGTGGGAGTCCCAGATGG - Intergenic
1121387760 14:93544429-93544451 CTTTCGGGGGGGTTAACAGAAGG + Intronic
1124249538 15:28097772-28097794 CTGCAGGGGGGATTCCCAGTTGG - Intronic
1128451011 15:67805879-67805901 CTTCCCTGGGAATTCCCAGGAGG + Intronic
1128755501 15:70180967-70180989 CTTTCCTGGGATTTCCCAGGAGG - Intergenic
1130263803 15:82380602-82380624 CTCTTGGGACGATTCCCAGGAGG + Intergenic
1132291278 15:100705491-100705513 CTTTGGGAGGGAGTCCCAGGAGG + Intergenic
1139121144 16:64018799-64018821 CTTTTGTTGGGTTTCCCAGGTGG + Intergenic
1144462636 17:15470124-15470146 ATTTCAGGGGGATTCTCAGGTGG - Intronic
1146872482 17:36385446-36385468 CTGTGGGGCTGATTCCCAGGAGG + Intronic
1148958363 17:51372330-51372352 CTTTTGGGATGATTCCTAGGAGG + Intergenic
1150069778 17:62140579-62140601 CTTTGGCGGGGAGTCCCGGGCGG + Intergenic
1151959557 17:77398480-77398502 CTTTGAGGAGGATTCCCAAGAGG + Intronic
1160319554 18:77877462-77877484 CTCTCGGGGGGCTGGCCAGGTGG - Intergenic
1161856439 19:6768177-6768199 CATTCAGGTGGTTTCCCAGGTGG + Intergenic
1164565614 19:29323859-29323881 ATGTCGGGGGCAATCCCAGGAGG - Intergenic
1164835002 19:31350519-31350541 CTCTCGGGGGGAGCCCCTGGCGG - Intergenic
924969402 2:111086-111108 CCTTCATGGGGATTCCCAGTTGG - Intergenic
926503059 2:13678509-13678531 CTTTTGGGATGATTCCCAAGAGG - Intergenic
927179347 2:20433452-20433474 CTTCCGGGTGGATTCCAAGTTGG - Intergenic
932776284 2:74530062-74530084 CTTTGGGGGGCATTCGCTGGGGG + Exonic
947727754 2:232410357-232410379 CTGTGGTGGGGATCCCCAGGGGG + Exonic
948279416 2:236735092-236735114 CTTTAGGTGTCATTCCCAGGAGG - Intergenic
948578928 2:238971124-238971146 CTTTCTGGGGTATTCCTGGGAGG - Intergenic
1172304684 20:33872415-33872437 CATTGGGGGAGATGCCCAGGAGG + Intergenic
1173578216 20:44126796-44126818 CTTGTGAGGGGCTTCCCAGGAGG - Intronic
1175466688 20:59194335-59194357 TCTTCTGGGGCATTCCCAGGAGG - Exonic
1178983131 21:37282036-37282058 CTGTAGGGGGGATTCAAAGGGGG - Intergenic
1184550488 22:45201943-45201965 CCCTCAGGAGGATTCCCAGGTGG - Intronic
1184856060 22:47147453-47147475 CTGTCGGAGGGCTCCCCAGGGGG + Intronic
950493820 3:13321972-13321994 CTTTATAGGGGATTCCCAGGAGG - Intronic
954532553 3:51333450-51333472 TTTTAGTGGGGAATCCCAGGAGG - Intronic
960877028 3:122307300-122307322 TTTTCTGGGGGCTTCCCAGTTGG - Intergenic
961665554 3:128491547-128491569 CCTCCGGGGGGGTTCCCAAGGGG + Intronic
968693408 4:2008447-2008469 CCTAGTGGGGGATTCCCAGGGGG + Intronic
970007736 4:11427504-11427526 CTTTTGGGGGGATTCTAGGGAGG - Intronic
1000723108 5:164733233-164733255 CTTTTGGGTGCATACCCAGGAGG - Intergenic
1006296728 6:33173159-33173181 CTGTGGGGCAGATTCCCAGGAGG + Intronic
1008492793 6:52103448-52103470 CTCCCAGGGGGATACCCAGGAGG + Intergenic
1019506829 7:1395580-1395602 CTTCCGGTGGGATCCCCTGGAGG + Intergenic
1024476446 7:49816978-49817000 ATTTGGGGTGGAGTCCCAGGGGG - Intronic
1031358826 7:120822339-120822361 CTTTAGGGGGAAATCCTAGGGGG - Intronic
1035225429 7:157429847-157429869 TTTTCTGGGGGAGTCCCATGAGG - Intergenic
1040599489 8:48870157-48870179 CTTTCATGGGGACCCCCAGGCGG - Intergenic
1040616456 8:49042721-49042743 CTGTGCTGGGGATTCCCAGGGGG + Intergenic
1055878004 9:80966237-80966259 CCTTCAGGGGGCATCCCAGGAGG - Intergenic
1056953937 9:91067539-91067561 CTTTCTGTGGGAATCCCAGGAGG - Intergenic
1057281296 9:93713390-93713412 CTATGGAGGGGAGTCCCAGGAGG + Intergenic
1062046922 9:134428617-134428639 CTTTCGGGGGGATTCCCAGGGGG - Intronic
1187410946 X:19050104-19050126 CTTTGGGAGGTAATCCCAGGAGG + Intronic
1191303635 X:58967545-58967567 CTTTCTGTGGGATCCCCAAGGGG + Intergenic
1191307203 X:59014794-59014816 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191314252 X:59109279-59109301 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191328831 X:59304158-59304180 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191329130 X:59308270-59308292 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191340481 X:59459991-59460013 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191354308 X:59644811-59644833 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191355384 X:59659214-59659236 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191358750 X:59703961-59703983 CTTTCTGTGGGATCCCCAAGGGG + Intergenic
1191359062 X:59708075-59708097 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191361518 X:59740995-59741017 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191366089 X:59802024-59802046 CTTTCTGTGGGATCCCCAAGGGG + Intergenic
1191367542 X:59821388-59821410 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191375039 X:59921670-59921692 CTTTCTGTGGGATCCCCAAGGGG + Intergenic
1191385109 X:60056246-60056268 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191386799 X:60078874-60078896 CTTTCTGTGGGATCCCCAAGGGG + Intergenic
1191391034 X:60135445-60135467 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191399618 X:60250626-60250648 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191410550 X:60397333-60397355 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191412995 X:60430240-60430262 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191431585 X:60679201-60679223 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191438133 X:60766793-60766815 CTTTCTGGGGGATCCGCAAGGGG + Intergenic
1191445154 X:60860570-60860592 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191459485 X:61052412-61052434 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191459796 X:61056526-61056548 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191461179 X:61075044-61075066 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191466626 X:61147890-61147912 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191469295 X:61183712-61183734 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191473655 X:61242168-61242190 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191497314 X:61558640-61558662 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191500051 X:61595332-61595354 CTTTCTGTGGGATCCCCAAGGGG + Intergenic
1191505273 X:61664940-61664962 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191505583 X:61669053-61669075 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191508661 X:61710186-61710208 CTTTCTGGGGGATCCGCAAGGGG + Intergenic
1191522860 X:61900283-61900305 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191540283 X:62133538-62133560 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191544596 X:62191149-62191171 CTTTCTGTGGGATCCGCAGGGGG + Intergenic
1191558087 X:62371481-62371503 CTTTCTGTGGGATCCGCAGGGGG + Intergenic