ID: 1062046923

View in Genome Browser
Species Human (GRCh38)
Location 9:134428618-134428640
Sequence TCTTTCGGGGGGATTCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062046923_1062046937 29 Left 1062046923 9:134428618-134428640 CCCCTGGGAATCCCCCCGAAAGA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1062046937 9:134428670-134428692 TTGGATAACCTGCTGTTTGGTGG No data
1062046923_1062046936 26 Left 1062046923 9:134428618-134428640 CCCCTGGGAATCCCCCCGAAAGA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046923_1062046933 10 Left 1062046923 9:134428618-134428640 CCCCTGGGAATCCCCCCGAAAGA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062046923 Original CRISPR TCTTTCGGGGGGATTCCCAG GGG (reversed) Intronic
914799080 1:150946775-150946797 TCATCAGGGAGGATTCCCAGAGG + Intronic
915142690 1:153776969-153776991 TCTTTCTGTGGGAAACCCAGCGG + Intronic
1064183616 10:13141320-13141342 TTTTTCAGGGGGCTTCCCAGGGG - Intergenic
1073094939 10:100973549-100973571 TCTCTGGGGAGGCTTCCCAGTGG - Exonic
1081676751 11:44974465-44974487 TCTTCTGGGGGGATTGGCAGAGG + Intergenic
1092826838 12:12408298-12408320 TCTTTTGGGTGCATACCCAGAGG + Intronic
1096749069 12:53747413-53747435 TCTTTGGGGGAGAAACCCAGTGG + Intergenic
1099553487 12:84078201-84078223 TCTTTCAGTGGGATTCCCAAAGG - Intergenic
1101041599 12:100761263-100761285 TCTCTTGGGGTGATTTCCAGTGG + Intronic
1104814686 12:131638914-131638936 TCTGCCGGGTGGATTCCTAGAGG - Intergenic
1105744251 13:23361885-23361907 TCTTTCTTGGGTATTCCCTGGGG - Intronic
1109477616 13:62903355-62903377 TCTTTTGGATAGATTCCCAGAGG - Intergenic
1113437165 13:110302114-110302136 TCTTTCTGGATGCTTCCCAGAGG - Intronic
1113936930 13:113999742-113999764 TCTGCCGGGGGGTCTCCCAGGGG + Intronic
1128339259 15:66808912-66808934 TCGCTCTGGGGGATTCTCAGTGG + Intergenic
1132639198 16:970117-970139 GCGTTCGGGAAGATTCCCAGCGG - Intronic
1133003188 16:2861532-2861554 TCCTTTGGGTGGATGCCCAGTGG - Intergenic
1135697843 16:24605771-24605793 TCCTTTGGGTGGATACCCAGTGG - Intergenic
1138986114 16:62330750-62330772 TCTTCCAGAGGGATTCCCATTGG + Intergenic
1139165514 16:64560633-64560655 TATTTCACGTGGATTCCCAGTGG + Intergenic
1139712941 16:68790318-68790340 TCTTTCTGTTGGATTCCCCGAGG - Intronic
1147237422 17:39068148-39068170 GCTTTCGGCAGGTTTCCCAGTGG - Intronic
1147332349 17:39706383-39706405 TCTTCATGGGGGACTCCCAGAGG + Intronic
1154303312 18:13213410-13213432 TGCTTCGGGGGGAGGCCCAGTGG + Intergenic
1155903161 18:31416265-31416287 TCTTTTGGGTAGATGCCCAGTGG + Intergenic
1156264088 18:35470265-35470287 TACTTAGGGGGGGTTCCCAGTGG - Intronic
1157578771 18:48761234-48761256 TCTTTGGTGGAGGTTCCCAGAGG + Intronic
1167388900 19:49181436-49181458 TCTTTCGGGGGGACATCCAATGG + Exonic
926544864 2:14226924-14226946 TATTTCCTGGAGATTCCCAGGGG + Intergenic
932114343 2:69032533-69032555 TCTTTCTGGGGGATGCAAAGTGG + Intronic
932128502 2:69166953-69166975 CCTTTCTGTGAGATTCCCAGGGG + Intronic
932702857 2:74002863-74002885 GATCTCGGGGGGATTCTCAGAGG + Intronic
933397507 2:81752317-81752339 TCTTTGGGGAGGACTGCCAGAGG + Intergenic
933705717 2:85288452-85288474 TTTTTCGGAGGGAGTCACAGAGG + Intronic
948049806 2:234971489-234971511 TCTTTTGGGTATATTCCCAGAGG + Intronic
1169269480 20:4188048-4188070 TCTGTGGGGGGGACCCCCAGTGG + Intergenic
1169812209 20:9619715-9619737 TCCTTCCAGGGGATTCCTAGAGG + Intronic
1171365023 20:24617657-24617679 TCTTTTGGGGGGCTTCCTTGTGG - Intronic
1175994825 20:62807360-62807382 TCTTTTTTGGGGGTTCCCAGTGG - Intronic
1178983132 21:37282037-37282059 TCTGTAGGGGGGATTCAAAGGGG - Intergenic
1181506837 22:23364328-23364350 TGTTTCTGGGGGATTTCCTGTGG + Intergenic
1184856059 22:47147452-47147474 TCTGTCGGAGGGCTCCCCAGGGG + Intronic
949848323 3:8394784-8394806 TCTTTTGGGTAGATACCCAGTGG - Intergenic
950210519 3:11119601-11119623 CCTTTCGGGGGGATAACTAGAGG + Intergenic
951810254 3:26690561-26690583 TTTTTCCGGGTGCTTCCCAGAGG + Intronic
951893111 3:27585167-27585189 TCTTCCTAGGGGATTCCCTGAGG - Intergenic
954281751 3:49585138-49585160 TCTTTTGGGTGGATACCCAGTGG + Intronic
956843651 3:73162474-73162496 TCTTTTGGGGATATACCCAGAGG + Intergenic
961746936 3:129069964-129069986 TCCTTCTGGTGAATTCCCAGAGG + Intergenic
963082161 3:141404079-141404101 TCTTTCTGAGGGACTCCCAAAGG + Intronic
963607696 3:147424851-147424873 TGGTTTGGGGGGATTCCTAGTGG + Intronic
968727985 4:2257010-2257032 TGTTTCGGGGGGTTCCCTAGAGG - Intronic
970649706 4:18162769-18162791 TCCTTTGGGTGGATACCCAGTGG + Intergenic
971487765 4:27177396-27177418 TCTCTAGAGGAGATTCCCAGCGG - Intergenic
974552586 4:63397308-63397330 TCTTTTGGGTGTATGCCCAGTGG + Intergenic
977905625 4:102475088-102475110 TCTTTTGGGAGGGCTCCCAGTGG + Intergenic
986017859 5:3773878-3773900 TCTCCTGGGGGGTTTCCCAGTGG + Intergenic
991013430 5:61907797-61907819 TCTTTTGGGTAGATACCCAGTGG - Intergenic
992656599 5:78916491-78916513 TCTTGAGGTAGGATTCCCAGGGG - Intronic
1001925853 5:175636479-175636501 TCCTTTGGGTAGATTCCCAGTGG - Intergenic
1002638654 5:180620185-180620207 GCTCTCGGGGGAATTCCCACTGG + Exonic
1004128992 6:12901344-12901366 TCTTTGGGGAGGATTACAAGAGG - Intronic
1013591746 6:111624553-111624575 TCTTTTGGGGATATACCCAGAGG - Intergenic
1019551493 7:1605061-1605083 TCTCTCGGGTATATTCCCAGGGG - Intergenic
1030153869 7:106432294-106432316 TCCTTTGGGTGGATACCCAGTGG - Intergenic
1031358827 7:120822340-120822362 TCTTTAGGGGGAAATCCTAGGGG - Intronic
1031428318 7:121635141-121635163 TGTTTCTAGGGGATTACCAGAGG + Intergenic
1034740922 7:153472568-153472590 TGTTTCTGGCTGATTCCCAGCGG - Intergenic
1037477826 8:19274891-19274913 TCTTTAGGGCAGATTCCCAGAGG - Intergenic
1042484243 8:69333734-69333756 TCCTTCGGGAGCAATCCCAGTGG + Intergenic
1045935514 8:107674274-107674296 TCTTTTGGGGTGATTGCCAATGG + Intergenic
1050453070 9:5804376-5804398 TCTTCCCTTGGGATTCCCAGAGG - Intronic
1053034195 9:34810312-34810334 TCTATTGGGGGGAGTCCCTGAGG + Intergenic
1058928598 9:109695299-109695321 TCTTTTGGATGTATTCCCAGCGG + Intronic
1062046923 9:134428618-134428640 TCTTTCGGGGGGATTCCCAGGGG - Intronic
1186131958 X:6477548-6477570 TCTTTTGGGTGTATACCCAGTGG + Intergenic
1186671393 X:11770698-11770720 TCTAGTCGGGGGATTCCCAGTGG - Intronic
1189317429 X:40065909-40065931 TCTCTCGGGGGCATTGCCAGCGG + Intronic
1189662603 X:43318013-43318035 TTTCTCAGAGGGATTCCCAGTGG + Intergenic
1191303634 X:58967544-58967566 TCTTTCTGTGGGATCCCCAAGGG + Intergenic
1191307202 X:59014793-59014815 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191314251 X:59109278-59109300 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191328830 X:59304157-59304179 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191329129 X:59308269-59308291 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191340480 X:59459990-59460012 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191354307 X:59644810-59644832 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191355383 X:59659213-59659235 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191358749 X:59703960-59703982 TCTTTCTGTGGGATCCCCAAGGG + Intergenic
1191359061 X:59708074-59708096 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191361517 X:59740994-59741016 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191366088 X:59802023-59802045 TCTTTCTGTGGGATCCCCAAGGG + Intergenic
1191367541 X:59821387-59821409 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191375038 X:59921669-59921691 TCTTTCTGTGGGATCCCCAAGGG + Intergenic
1191385108 X:60056245-60056267 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191386798 X:60078873-60078895 TCTTTCTGTGGGATCCCCAAGGG + Intergenic
1191391033 X:60135444-60135466 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191399617 X:60250625-60250647 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191410549 X:60397332-60397354 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191412994 X:60430239-60430261 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191431584 X:60679200-60679222 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191438132 X:60766792-60766814 TCTTTCTGGGGGATCCGCAAGGG + Intergenic
1191445153 X:60860569-60860591 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191459484 X:61052411-61052433 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191459795 X:61056525-61056547 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191461178 X:61075043-61075065 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191466625 X:61147889-61147911 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191469294 X:61183711-61183733 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191473654 X:61242167-61242189 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191497313 X:61558639-61558661 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191500050 X:61595331-61595353 TCTTTCTGTGGGATCCCCAAGGG + Intergenic
1191505272 X:61664939-61664961 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191505582 X:61669052-61669074 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191508660 X:61710185-61710207 TCTTTCTGGGGGATCCGCAAGGG + Intergenic
1191522859 X:61900282-61900304 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191540282 X:62133537-62133559 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191544595 X:62191148-62191170 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1191558086 X:62371480-62371502 TCTTTCTGTGGGATCCGCAGGGG + Intergenic
1192168999 X:68842963-68842985 TCTTGTGGGGGGACTCCCTGTGG + Intergenic