ID: 1062046924

View in Genome Browser
Species Human (GRCh38)
Location 9:134428619-134428641
Sequence CTCTTTCGGGGGGATTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1876
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 1863}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062046924_1062046936 25 Left 1062046924 9:134428619-134428641 CCCTGGGAATCCCCCCGAAAGAG 0: 1
1: 0
2: 0
3: 12
4: 1863
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046924_1062046933 9 Left 1062046924 9:134428619-134428641 CCCTGGGAATCCCCCCGAAAGAG 0: 1
1: 0
2: 0
3: 12
4: 1863
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046924_1062046937 28 Left 1062046924 9:134428619-134428641 CCCTGGGAATCCCCCCGAAAGAG 0: 1
1: 0
2: 0
3: 12
4: 1863
Right 1062046937 9:134428670-134428692 TTGGATAACCTGCTGTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062046924 Original CRISPR CTCTTTCGGGGGGATTCCCA GGG (reversed) Intronic
909032786 1:70561577-70561599 CTCTTTGGTGGGCATTCGCATGG + Intergenic
920236261 1:204508142-204508164 CTCTTTCGGGGTGATTGCTCTGG + Intergenic
920399916 1:205670136-205670158 CTCTTTCTGGGGTGTCCCCAAGG - Intronic
1064183617 10:13141321-13141343 GTTTTTCAGGGGGCTTCCCAGGG - Intergenic
1073178241 10:101569414-101569436 CCCTTGCTGGGGGCTTCCCAAGG - Intergenic
1075139928 10:119823410-119823432 ATCTTTAGCGGGGATTCTCAGGG + Intronic
1076180621 10:128404645-128404667 GTCTTTCAGTGGGATTCCCTGGG + Intergenic
1076449750 10:130548722-130548744 CTCTATTCGGGGGATTCCCTGGG + Intergenic
1078057241 11:8018644-8018666 CTCTCCCGGGTGGATTCCCTCGG - Intergenic
1079099846 11:17534282-17534304 CTCTTTCTGTGGGTATCCCAAGG + Intronic
1083453358 11:62761582-62761604 GTGTTTCCGGTGGATTCCCAGGG + Exonic
1093195732 12:16127723-16127745 CTTTTGTGGGGTGATTCCCATGG + Intergenic
1096485370 12:51976766-51976788 CTCATTCCGTGGGATTCCCAAGG + Intronic
1097763816 12:63499918-63499940 CTCTTGCCTGGGGAGTCCCAAGG + Intergenic
1104730222 12:131101244-131101266 ATCTCTTGGGGGGCTTCCCAGGG + Intronic
1105963998 13:25368872-25368894 CCCTTTCCCGGTGATTCCCAAGG - Intergenic
1111034548 13:82655548-82655570 CTCTTGCTTGGGGAGTCCCAAGG + Intergenic
1113936929 13:113999741-113999763 CTCTGCCGGGGGGTCTCCCAGGG + Intronic
1116288725 14:43005527-43005549 CACTTTAGGGAGGATTGCCAAGG + Intergenic
1117823222 14:59673202-59673224 CTCTTGCTTGGGGAGTCCCAAGG + Intronic
1138519272 16:57561763-57561785 GTCTTTCTGGGGGCTTCCCCAGG - Intronic
1138992598 16:62409626-62409648 CTCTGCCGTGGGGAGTCCCAAGG + Intergenic
1144991887 17:19238432-19238454 CTCCGGCGGGGGGATTCACAGGG - Intronic
1152084112 17:78206976-78206998 CTCTTTGGAGAGGCTTCCCAAGG - Exonic
1152111193 17:78358606-78358628 CTCTTCTGGGGGGACTCCCAGGG + Exonic
1155332838 18:24735036-24735058 CTCTTTCCTGGGTGTTCCCAGGG + Intergenic
930031092 2:47058489-47058511 CTCTTTCTGGGAGCTTCCCTTGG + Intronic
932052850 2:68416454-68416476 CTCTTGCTCGGGGAGTCCCAAGG + Intergenic
932960342 2:76406253-76406275 CTCTGGCTGGGGGAATCCCAAGG - Intergenic
935740184 2:106140508-106140530 CTCTTTAGGGTGGGTGCCCAGGG + Intronic
937750119 2:125466853-125466875 CTTTTTCGGGGACATTCCGAAGG - Intergenic
947752131 2:232538717-232538739 CTCAGTGGGGGGGATGCCCAGGG + Intergenic
1169355335 20:4900693-4900715 TTCTTTCTGGAAGATTCCCATGG - Intronic
1173303785 20:41828803-41828825 CTCTCACGTGGGGAGTCCCAAGG - Intergenic
1177207711 21:18029648-18029670 CTGTTTTGGGGGGAATCTCAGGG + Intronic
1179365384 21:40754331-40754353 CTCCTTCTGGGGGATTCTGAAGG - Intronic
1181022174 22:20109364-20109386 CTCTTTGAGTGGGGTTCCCAAGG - Intronic
955655102 3:61236954-61236976 CTATTTCAGGGGGATTCCATTGG - Intronic
960004412 3:112767440-112767462 CTCTCTCTGTGGGATTTCCATGG - Intronic
964663672 3:159149831-159149853 CTCTTTAGGGAGGCTTCCAAGGG + Intronic
977031128 4:91884999-91885021 CTCCTTCAGGGGGAGTCCCTGGG - Intergenic
978308798 4:107363241-107363263 CTCTGACGGGGGTATACCCAAGG + Intergenic
985553798 5:546363-546385 CTCTTTCCCGGGCCTTCCCAGGG - Intergenic
990048772 5:51468881-51468903 CTCTTTCAGGGTGACTTCCACGG - Intergenic
995825242 5:116289587-116289609 GGCTTTCTGGGGGATTCCCAAGG - Intronic
995930798 5:117440278-117440300 CTCTTTCACTGGTATTCCCAAGG + Intergenic
1003978225 6:11364438-11364460 ACCTTTGGGGGGAATTCCCAAGG - Intronic
1007079139 6:39086383-39086405 CTCTGTCTGGGGGAACCCCAAGG - Exonic
1019406413 7:886414-886436 CTTTTTCGGCGGCATTGCCAAGG + Intronic
1020938903 7:14505865-14505887 CTCTTTCCTGTGGATTCCAAAGG + Intronic
1021428298 7:20529282-20529304 CTCTTGCTTGGGGAATCCCAAGG - Intergenic
1034200692 7:149281564-149281586 CTCTTTCTGGGGGTGTCCCGAGG + Exonic
1040786824 8:51176411-51176433 CTTTTGCCTGGGGATTCCCAAGG + Intergenic
1043878200 8:85510302-85510324 GTCTTTCTGGGTGATTCACATGG + Intergenic
1045519918 8:102894658-102894680 CTCTTTCTGGGGTATTCCCCTGG - Intronic
1057293824 9:93824071-93824093 CTCTGTGGGGTGCATTCCCAAGG - Intergenic
1062046924 9:134428619-134428641 CTCTTTCGGGGGGATTCCCAGGG - Intronic
1190416768 X:50187912-50187934 CACTTTCTGGGAGATTGCCAAGG - Intergenic
1191275187 X:58537051-58537073 CTCTTTCTGTGGGATCCACAAGG - Intergenic
1191275342 X:58539112-58539134 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191275496 X:58541170-58541192 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191275647 X:58543227-58543249 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191275797 X:58545284-58545306 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191275948 X:58547341-58547363 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191276098 X:58549398-58549420 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191276248 X:58551455-58551477 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191276399 X:58553512-58553534 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191276616 X:58606528-58606550 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191276769 X:58608582-58608604 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191276918 X:58610640-58610662 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191277074 X:58612697-58612719 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191277229 X:58614754-58614776 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191277386 X:58616813-58616835 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191277541 X:58618871-58618893 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191277674 X:58620760-58620782 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191277828 X:58622817-58622839 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191277979 X:58624874-58624896 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191278133 X:58626931-58626953 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191278288 X:58628988-58629010 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191278443 X:58631045-58631067 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191278603 X:58633103-58633125 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191278759 X:58635161-58635183 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191278913 X:58637218-58637240 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191279064 X:58639274-58639296 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191279218 X:58641333-58641355 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191279370 X:58643391-58643413 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191279520 X:58645448-58645470 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191279674 X:58647506-58647528 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191279828 X:58649563-58649585 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191279982 X:58651622-58651644 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191280136 X:58653678-58653700 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191280287 X:58655736-58655758 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191280433 X:58657794-58657816 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191280583 X:58659851-58659873 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191280723 X:58661737-58661759 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191280880 X:58663794-58663816 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191281035 X:58665852-58665874 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191281190 X:58667909-58667931 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191281344 X:58669966-58669988 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191281492 X:58672024-58672046 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191281797 X:58676143-58676165 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191281951 X:58678201-58678223 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191282106 X:58680258-58680280 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191282262 X:58682315-58682337 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191282415 X:58684372-58684394 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191282566 X:58686429-58686451 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191282724 X:58688486-58688508 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191282875 X:58690544-58690566 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191283027 X:58692601-58692623 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191283180 X:58694658-58694680 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191283339 X:58696715-58696737 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191283492 X:58698773-58698795 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191283645 X:58700831-58700853 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191283960 X:58704944-58704966 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191284106 X:58707001-58707023 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191284258 X:58709057-58709079 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191284409 X:58711114-58711136 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191284558 X:58713175-58713197 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191284687 X:58714891-58714913 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191284844 X:58716948-58716970 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191285003 X:58719004-58719026 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191285160 X:58721061-58721083 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191285314 X:58723118-58723140 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191285467 X:58725175-58725197 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191285621 X:58727232-58727254 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191285774 X:58729289-58729311 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191285930 X:58731345-58731367 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191286084 X:58733402-58733424 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191286238 X:58735458-58735480 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191286405 X:58737747-58737769 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191286561 X:58739804-58739826 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191286717 X:58741861-58741883 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191286868 X:58743918-58743940 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191287147 X:58747691-58747713 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191287300 X:58749748-58749770 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191287453 X:58751804-58751826 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191287608 X:58753862-58753884 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191287759 X:58755919-58755941 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191287911 X:58757975-58757997 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191288061 X:58760032-58760054 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191288209 X:58762088-58762110 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191288362 X:58764145-58764167 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191288515 X:58766200-58766222 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191288667 X:58768257-58768279 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191288822 X:58770314-58770336 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191288976 X:58772372-58772394 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191289131 X:58774428-58774450 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191289285 X:58776485-58776507 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191289441 X:58778542-58778564 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191289596 X:58780599-58780621 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191289749 X:58782654-58782676 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191289904 X:58784711-58784733 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191290059 X:58786768-58786790 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191290214 X:58788828-58788850 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191290366 X:58790884-58790906 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191290518 X:58792941-58792963 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191290673 X:58794998-58795020 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191290829 X:58797056-58797078 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191290981 X:58799114-58799136 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191291139 X:58801171-58801193 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191291297 X:58803228-58803250 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191291510 X:58805725-58805747 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191291661 X:58807782-58807804 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191291815 X:58809838-58809860 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191291970 X:58811896-58811918 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191292124 X:58813953-58813975 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191292282 X:58816010-58816032 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191292440 X:58818067-58818089 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191292594 X:58820126-58820148 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191292750 X:58822184-58822206 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191292902 X:58824241-58824263 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191293055 X:58826298-58826320 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191293204 X:58828356-58828378 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191293364 X:58830413-58830435 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191293521 X:58832469-58832491 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191293672 X:58834525-58834547 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191293824 X:58836582-58836604 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191293979 X:58838639-58838661 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191294133 X:58840696-58840718 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191294284 X:58842754-58842776 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191294437 X:58844811-58844833 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191294590 X:58846870-58846892 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191294743 X:58848928-58848950 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191294894 X:58850985-58851007 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191295045 X:58853041-58853063 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191295197 X:58855098-58855120 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191295346 X:58857155-58857177 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191295498 X:58859211-58859233 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191295651 X:58861268-58861290 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191295805 X:58863325-58863347 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191295960 X:58865382-58865404 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191296116 X:58867439-58867461 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191296269 X:58869493-58869515 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191296429 X:58871553-58871575 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191296583 X:58873607-58873629 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191296735 X:58875665-58875687 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191296892 X:58877722-58877744 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191297047 X:58879779-58879801 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191297178 X:58881495-58881517 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191297332 X:58883552-58883574 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191297488 X:58885608-58885630 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191297644 X:58887666-58887688 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191297797 X:58889722-58889744 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191297955 X:58891779-58891801 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191298112 X:58893837-58893859 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191298268 X:58895894-58895916 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191298421 X:58897951-58897973 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191298576 X:58900008-58900030 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191298731 X:58902066-58902088 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191298888 X:58904123-58904145 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191299108 X:58907031-58907053 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191299238 X:58908747-58908769 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191299386 X:58910803-58910825 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191299535 X:58912859-58912881 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191299667 X:58914747-58914769 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191299821 X:58916804-58916826 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191299976 X:58918861-58918883 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191300130 X:58920918-58920940 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191300285 X:58922975-58922997 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191300441 X:58925034-58925056 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191300598 X:58927091-58927113 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191300754 X:58929148-58929170 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191300909 X:58931205-58931227 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191301061 X:58933262-58933284 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191301214 X:58935319-58935341 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191301370 X:58937376-58937398 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191301528 X:58939433-58939455 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191301683 X:58941490-58941512 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191301838 X:58943548-58943570 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191301992 X:58945604-58945626 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191302123 X:58947320-58947342 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191302271 X:58949375-58949397 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191302422 X:58951432-58951454 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191302576 X:58953489-58953511 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191302729 X:58955543-58955565 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191302884 X:58957600-58957622 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191303039 X:58959656-58959678 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191303195 X:58961714-58961736 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191303350 X:58963771-58963793 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191303502 X:58965827-58965849 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191303633 X:58967543-58967565 CTCTTTCTGTGGGATCCCCAAGG + Intergenic
1191303793 X:58969600-58969622 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191303949 X:58971657-58971679 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191304093 X:58973544-58973566 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191304243 X:58975598-58975620 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191304376 X:58977314-58977336 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191304531 X:58979371-58979393 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191304683 X:58981428-58981450 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191304840 X:58983485-58983507 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191304997 X:58985542-58985564 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191305149 X:58987600-58987622 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191305362 X:58990101-58990123 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191305516 X:58992158-58992180 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191305672 X:58994215-58994237 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191305826 X:58996276-58996298 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191305980 X:58998333-58998355 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191306288 X:59002448-59002470 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191306435 X:59004505-59004527 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191306584 X:59006565-59006587 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191306737 X:59008619-59008641 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191306892 X:59010677-59010699 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191307049 X:59012734-59012756 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191307201 X:59014792-59014814 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191307354 X:59016850-59016872 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191307511 X:59018907-59018929 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191307667 X:59020964-59020986 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191307823 X:59023021-59023043 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191307976 X:59025077-59025099 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191308133 X:59027134-59027156 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191308285 X:59029192-59029214 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191308437 X:59031245-59031267 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191308584 X:59033301-59033323 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191308736 X:59035359-59035381 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191308894 X:59037416-59037438 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191309052 X:59039476-59039498 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191309203 X:59041534-59041556 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191309357 X:59043591-59043613 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191309509 X:59045649-59045671 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191309667 X:59047706-59047728 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191309822 X:59049763-59049785 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191309978 X:59051820-59051842 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191310134 X:59053877-59053899 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191310285 X:59055934-59055956 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191310416 X:59057649-59057671 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191310719 X:59061763-59061785 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191310869 X:59063820-59063842 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191311040 X:59066056-59066078 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191311190 X:59068111-59068133 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191311343 X:59070169-59070191 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191311500 X:59072227-59072249 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191311654 X:59074305-59074327 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191311806 X:59076359-59076381 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191311959 X:59078417-59078439 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191312115 X:59080474-59080496 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191312269 X:59082535-59082557 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191312424 X:59084593-59084615 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191312581 X:59086650-59086672 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191312734 X:59088707-59088729 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191312885 X:59090764-59090786 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191313040 X:59092821-59092843 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191313196 X:59094878-59094900 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191313347 X:59096935-59096957 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191313501 X:59098992-59099014 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191313657 X:59101049-59101071 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191313810 X:59103108-59103130 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191313956 X:59105165-59105187 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191314102 X:59107221-59107243 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191314250 X:59109277-59109299 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191314399 X:59111334-59111356 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191314547 X:59113390-59113412 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191314700 X:59115446-59115468 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191314856 X:59117503-59117525 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191315006 X:59119560-59119582 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191315150 X:59121431-59121453 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191315305 X:59123489-59123511 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191315459 X:59125542-59125564 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191315616 X:59127599-59127621 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191315772 X:59129656-59129678 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191315924 X:59131713-59131735 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191316081 X:59133775-59133797 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191316236 X:59135832-59135854 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191316391 X:59137889-59137911 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191316547 X:59139945-59139967 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191316702 X:59142002-59142024 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191316856 X:59144059-59144081 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191317012 X:59146114-59146136 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191317145 X:59147830-59147852 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191317301 X:59149887-59149909 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191317460 X:59151944-59151966 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191317614 X:59154001-59154023 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191317769 X:59156060-59156082 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191317926 X:59158119-59158141 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191318081 X:59160176-59160198 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191318233 X:59162234-59162256 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191318388 X:59164291-59164313 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191318544 X:59166348-59166370 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191318698 X:59168405-59168427 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191318854 X:59170463-59170485 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191319156 X:59174576-59174598 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191319308 X:59176633-59176655 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191319458 X:59178689-59178711 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191319615 X:59180746-59180768 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191319770 X:59182803-59182825 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191319923 X:59184861-59184883 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191320080 X:59186919-59186941 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191320233 X:59188976-59188998 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191320381 X:59191033-59191055 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191320537 X:59193090-59193112 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191320694 X:59195146-59195168 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191320847 X:59197200-59197222 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191321003 X:59199257-59199279 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191321159 X:59201314-59201336 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191321314 X:59203371-59203393 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191321468 X:59205428-59205450 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191321620 X:59207485-59207507 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191321775 X:59209542-59209564 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191321929 X:59211599-59211621 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191322082 X:59213656-59213678 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191322237 X:59215712-59215734 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191322389 X:59217770-59217792 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191322545 X:59219827-59219849 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191322705 X:59221884-59221906 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191322856 X:59223941-59223963 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191323003 X:59225998-59226020 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191323155 X:59228055-59228077 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191323304 X:59230112-59230134 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191323452 X:59232169-59232191 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191323604 X:59234226-59234248 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191323757 X:59236283-59236305 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191323911 X:59238340-59238362 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191324064 X:59240397-59240419 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191324220 X:59242454-59242476 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191324378 X:59244510-59244532 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191324527 X:59246567-59246589 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191324675 X:59248624-59248646 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191324826 X:59250680-59250702 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191324983 X:59252737-59252759 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191325136 X:59254792-59254814 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191325289 X:59256849-59256871 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191325444 X:59258908-59258930 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191325591 X:59260965-59260987 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191325746 X:59263019-59263041 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191325896 X:59265076-59265098 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191326049 X:59267130-59267152 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191326204 X:59269187-59269209 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191326359 X:59271244-59271266 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191326513 X:59273302-59273324 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191326665 X:59275357-59275379 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191326822 X:59277413-59277435 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191326974 X:59279470-59279492 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191327129 X:59281526-59281548 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191327284 X:59283583-59283605 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191327435 X:59285641-59285663 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191327591 X:59287702-59287724 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191327743 X:59289756-59289778 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191327899 X:59291813-59291835 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191328056 X:59293871-59293893 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191328209 X:59295928-59295950 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191328366 X:59297985-59298007 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191328519 X:59300042-59300064 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191328673 X:59302099-59302121 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191328829 X:59304156-59304178 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191328974 X:59306212-59306234 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191329128 X:59308268-59308290 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191329281 X:59310325-59310347 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191329436 X:59312382-59312404 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191329591 X:59314439-59314461 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191329742 X:59316497-59316519 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191329892 X:59318552-59318574 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191330047 X:59320607-59320629 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191330202 X:59322664-59322686 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191330355 X:59324721-59324743 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191330507 X:59326778-59326800 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191330659 X:59328835-59328857 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191330811 X:59330892-59330914 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191330966 X:59332950-59332972 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191331123 X:59335007-59335029 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191331274 X:59337065-59337087 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191331410 X:59338956-59338978 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191331563 X:59341013-59341035 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191331717 X:59343071-59343093 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191331874 X:59345128-59345150 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191332163 X:59349076-59349098 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191332305 X:59350961-59350983 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191332455 X:59353018-59353040 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191332605 X:59355075-59355097 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191332759 X:59357132-59357154 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191332911 X:59359189-59359211 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191333065 X:59361247-59361269 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191333222 X:59363305-59363327 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191333379 X:59365362-59365384 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191333531 X:59367419-59367441 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191333686 X:59369477-59369499 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191333840 X:59371535-59371557 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191333989 X:59373586-59373608 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191334146 X:59375647-59375669 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191334299 X:59377704-59377726 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191334455 X:59379761-59379783 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191334616 X:59381820-59381842 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191334772 X:59383878-59383900 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191334927 X:59385935-59385957 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191335227 X:59390049-59390071 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191335381 X:59392106-59392128 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191335536 X:59394164-59394186 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191335691 X:59396221-59396243 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191335846 X:59398278-59398300 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191336002 X:59400336-59400358 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191336156 X:59402394-59402416 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191336312 X:59404450-59404472 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191336465 X:59406508-59406530 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191336618 X:59408562-59408584 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191336770 X:59410616-59410638 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191336922 X:59412673-59412695 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191337075 X:59414730-59414752 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191337232 X:59416787-59416809 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191337384 X:59418844-59418866 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191337539 X:59420901-59420923 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191337694 X:59422962-59422984 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191337850 X:59425019-59425041 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191338009 X:59427076-59427098 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191338164 X:59429134-59429156 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191338318 X:59431191-59431213 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191338473 X:59433248-59433270 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191338628 X:59435306-59435328 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191338780 X:59437360-59437382 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191338933 X:59439419-59439441 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191339088 X:59441476-59441498 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191339246 X:59443534-59443556 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191339401 X:59445591-59445613 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191339559 X:59447650-59447672 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191339712 X:59449704-59449726 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191339866 X:59451761-59451783 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191340019 X:59453817-59453839 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191340168 X:59455875-59455897 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191340326 X:59457932-59457954 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191340479 X:59459989-59460011 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191340778 X:59464103-59464125 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191340930 X:59466160-59466182 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191341085 X:59468219-59468241 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191341238 X:59470276-59470298 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191341392 X:59472333-59472355 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191341548 X:59474390-59474412 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191341702 X:59476448-59476470 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191341916 X:59478948-59478970 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191342222 X:59483063-59483085 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191342381 X:59485120-59485142 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191342534 X:59487177-59487199 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191342688 X:59489344-59489366 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191342824 X:59491237-59491259 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191342977 X:59493294-59493316 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191343135 X:59495351-59495373 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191343291 X:59497408-59497430 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191343444 X:59499465-59499487 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191343595 X:59501521-59501543 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191343747 X:59503581-59503603 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191343900 X:59505638-59505660 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191344054 X:59507695-59507717 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191344207 X:59509750-59509772 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191344360 X:59511807-59511829 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191344514 X:59513865-59513887 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191344667 X:59515922-59515944 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191344823 X:59517979-59518001 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191344977 X:59520036-59520058 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191345131 X:59522093-59522115 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191345283 X:59524150-59524172 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191345435 X:59526209-59526231 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191345591 X:59528265-59528287 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191345741 X:59530322-59530344 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191345896 X:59532379-59532401 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191346057 X:59534433-59534455 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191346213 X:59536490-59536512 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191346367 X:59538547-59538569 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191346518 X:59540604-59540626 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191346671 X:59542661-59542683 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191346826 X:59544718-59544740 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191346985 X:59546777-59546799 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191347138 X:59548836-59548858 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191347291 X:59550893-59550915 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191347444 X:59552950-59552972 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191347600 X:59555006-59555028 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191347753 X:59557063-59557085 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191347905 X:59559123-59559145 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191348057 X:59561180-59561202 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191348212 X:59563236-59563258 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191348366 X:59565292-59565314 CTCTTTCTGAGGGATCCGCAAGG + Intergenic
1191348676 X:59569402-59569424 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191348827 X:59571459-59571481 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191348979 X:59573516-59573538 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191349131 X:59575572-59575594 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191349285 X:59577629-59577651 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191349443 X:59579686-59579708 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191349598 X:59581740-59581762 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191349753 X:59583797-59583819 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191349901 X:59585851-59585873 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191350054 X:59587908-59587930 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191350209 X:59589965-59589987 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191350364 X:59592022-59592044 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191350518 X:59594079-59594101 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191350644 X:59595780-59595802 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191350791 X:59597836-59597858 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191350942 X:59599893-59599915 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191351098 X:59601950-59601972 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191351251 X:59604007-59604029 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191351402 X:59606064-59606086 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191351556 X:59608121-59608143 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191351712 X:59610178-59610200 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191351869 X:59612236-59612258 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191352024 X:59614293-59614315 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191352177 X:59616350-59616372 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191352310 X:59618068-59618090 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191352465 X:59620126-59620148 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191352617 X:59622183-59622205 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191352771 X:59624240-59624262 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191352926 X:59626297-59626319 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191353078 X:59628354-59628376 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191353232 X:59630411-59630433 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191353385 X:59632468-59632490 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191353536 X:59634525-59634547 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191353687 X:59636582-59636604 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191353847 X:59638639-59638661 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191354002 X:59640694-59640716 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191354151 X:59642752-59642774 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191354306 X:59644809-59644831 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191354460 X:59646866-59646888 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191354613 X:59648923-59648945 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191354770 X:59650980-59651002 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191355073 X:59655097-59655119 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191355227 X:59657154-59657176 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191355382 X:59659212-59659234 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191355537 X:59661270-59661292 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191355692 X:59663327-59663349 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191355847 X:59665385-59665407 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191355997 X:59667447-59667469 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191356154 X:59669504-59669526 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191356306 X:59671561-59671583 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191356459 X:59673617-59673639 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191356618 X:59675674-59675696 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191356769 X:59677731-59677753 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191356927 X:59679788-59679810 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191357081 X:59681845-59681867 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191357237 X:59683903-59683925 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191357389 X:59685959-59685981 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191357545 X:59688015-59688037 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191357703 X:59690072-59690094 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191357855 X:59692129-59692151 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191358009 X:59694186-59694208 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191358166 X:59696243-59696265 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191358317 X:59698300-59698322 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191358438 X:59699845-59699867 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191358593 X:59701902-59701924 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191358748 X:59703959-59703981 CTCTTTCTGTGGGATCCCCAAGG + Intergenic
1191358904 X:59706016-59706038 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191359060 X:59708073-59708095 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191359212 X:59710131-59710153 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191359364 X:59712192-59712214 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191359519 X:59714249-59714271 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191359673 X:59716306-59716328 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191359829 X:59718364-59718386 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191359982 X:59720421-59720443 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191360131 X:59722476-59722498 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191360283 X:59724533-59724555 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191360441 X:59726592-59726614 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191360594 X:59728650-59728672 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191360746 X:59730707-59730729 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191360900 X:59732764-59732786 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191361056 X:59734822-59734844 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191361209 X:59736879-59736901 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191361365 X:59738936-59738958 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191361516 X:59740993-59741015 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191361668 X:59743051-59743073 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191361818 X:59745108-59745130 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191361970 X:59747166-59747188 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191362125 X:59749223-59749245 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191362279 X:59751282-59751304 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191362430 X:59753339-59753361 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191362587 X:59755397-59755419 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191362738 X:59757454-59757476 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191362892 X:59759511-59759533 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191363048 X:59761568-59761590 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191363192 X:59763454-59763476 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191363345 X:59765511-59765533 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191363500 X:59767565-59767587 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191363655 X:59769622-59769644 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191363786 X:59771338-59771360 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191363943 X:59773395-59773417 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191364097 X:59775452-59775474 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191364252 X:59777509-59777531 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191364407 X:59779565-59779587 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191364563 X:59781622-59781644 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191364714 X:59783679-59783701 CTCTTTCTGAGGGATCCGCAAGG + Intergenic
1191364871 X:59785738-59785760 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191365027 X:59787796-59787818 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191365180 X:59789854-59789876 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191365336 X:59791911-59791933 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191365477 X:59793799-59793821 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191365626 X:59795855-59795877 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191365780 X:59797912-59797934 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191365935 X:59799968-59799990 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191366087 X:59802022-59802044 CTCTTTCTGTGGGATCCCCAAGG + Intergenic
1191366244 X:59804079-59804101 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191366398 X:59806137-59806159 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191366549 X:59808194-59808216 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191366705 X:59810250-59810272 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191366859 X:59812307-59812329 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191367011 X:59814363-59814385 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191367166 X:59816420-59816442 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191367385 X:59819328-59819350 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191367540 X:59821386-59821408 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191367829 X:59825335-59825357 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191367982 X:59827392-59827414 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191368135 X:59829449-59829471 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191368286 X:59831509-59831531 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191368438 X:59833566-59833588 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191368587 X:59835621-59835643 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191368744 X:59837679-59837701 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191368900 X:59839736-59839758 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191369054 X:59841794-59841816 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191369210 X:59843850-59843872 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191369366 X:59845907-59845929 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191369514 X:59847964-59847986 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191369662 X:59850020-59850042 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191369812 X:59852077-59852099 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191369969 X:59854133-59854155 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191370122 X:59856190-59856212 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191370278 X:59858247-59858269 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191370429 X:59860304-59860326 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191370586 X:59862359-59862381 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191370738 X:59864416-59864438 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191370891 X:59866473-59866495 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191371050 X:59868531-59868553 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191371204 X:59870588-59870610 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191371357 X:59872645-59872667 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191371514 X:59874702-59874724 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191371662 X:59876759-59876781 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191371812 X:59878817-59878839 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191371963 X:59880876-59880898 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191372121 X:59882933-59882955 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191372277 X:59884987-59885009 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191372432 X:59887044-59887066 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191372566 X:59888760-59888782 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191372720 X:59890815-59890837 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191372870 X:59892872-59892894 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191373024 X:59894930-59894952 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191373178 X:59896987-59897009 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191373332 X:59899044-59899066 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191373480 X:59901101-59901123 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191373636 X:59903158-59903180 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191373798 X:59905216-59905238 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191373955 X:59907272-59907294 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191374111 X:59909328-59909350 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191374268 X:59911385-59911407 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191374424 X:59913442-59913464 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191374580 X:59915499-59915521 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191374733 X:59917554-59917576 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191374885 X:59919611-59919633 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191375037 X:59921668-59921690 CTCTTTCTGTGGGATCCCCAAGG + Intergenic
1191375192 X:59923725-59923747 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191375344 X:59925782-59925804 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191375497 X:59927839-59927861 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191375811 X:59931952-59931974 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191376074 X:59935559-59935581 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191376231 X:59937617-59937639 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191376386 X:59939674-59939696 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191376539 X:59941731-59941753 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191376695 X:59943788-59943810 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191376847 X:59945842-59945864 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191377000 X:59947899-59947921 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191377153 X:59949956-59949978 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191377305 X:59952015-59952037 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191377455 X:59954072-59954094 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191377606 X:59956129-59956151 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191377762 X:59958186-59958208 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191377915 X:59960245-59960267 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191378068 X:59962305-59962327 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191378221 X:59964364-59964386 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191378377 X:59966421-59966443 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191378528 X:59968479-59968501 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191378678 X:59970538-59970560 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191378831 X:59972597-59972619 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191378987 X:59974655-59974677 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191379141 X:59976712-59976734 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191379298 X:59978768-59978790 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191379451 X:59980825-59980847 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191379603 X:59982882-59982904 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191379759 X:59984940-59984962 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191379914 X:59986997-59987019 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191380071 X:59989058-59989080 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191380228 X:59991117-59991139 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191380384 X:59993176-59993198 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191380536 X:59995234-59995256 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191380690 X:59997291-59997313 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191380843 X:59999348-59999370 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191380975 X:60001065-60001087 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191381131 X:60003121-60003143 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191381282 X:60005179-60005201 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191381435 X:60007236-60007258 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191381590 X:60009293-60009315 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191381742 X:60011350-60011372 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191381898 X:60013407-60013429 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191382051 X:60015463-60015485 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191382206 X:60017520-60017542 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191382360 X:60019578-60019600 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191382513 X:60021611-60021633 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191382642 X:60023327-60023349 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191382797 X:60025384-60025406 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191382948 X:60027442-60027464 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191383101 X:60029497-60029519 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191383259 X:60031554-60031576 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191383416 X:60033611-60033633 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191383570 X:60035669-60035691 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191383723 X:60037726-60037748 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191383878 X:60039783-60039805 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191384033 X:60041842-60041864 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191384185 X:60043901-60043923 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191384339 X:60045956-60045978 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191384495 X:60048013-60048035 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191384651 X:60050071-60050093 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191384802 X:60052129-60052151 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191384953 X:60054186-60054208 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191385107 X:60056244-60056266 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191385259 X:60058300-60058322 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191385414 X:60060357-60060379 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191385572 X:60062414-60062436 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191385725 X:60064471-60064493 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191385881 X:60066529-60066551 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191386030 X:60068587-60068609 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191386182 X:60070644-60070666 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191386335 X:60072701-60072723 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191386488 X:60074758-60074780 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191386643 X:60076815-60076837 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191386797 X:60078872-60078894 CTCTTTCTGTGGGATCCCCAAGG + Intergenic
1191386953 X:60080931-60080953 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191387095 X:60082821-60082843 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191387242 X:60084875-60084897 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191387396 X:60086932-60086954 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191387548 X:60088988-60089010 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191387707 X:60091044-60091066 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191387852 X:60092930-60092952 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191388004 X:60094987-60095009 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191388138 X:60096703-60096725 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191388292 X:60098760-60098782 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191388596 X:60102874-60102896 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191388752 X:60104932-60104954 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191388891 X:60106818-60106840 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191389047 X:60108873-60108895 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191389199 X:60110927-60110949 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191389351 X:60112985-60113007 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191389505 X:60115043-60115065 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191389660 X:60117100-60117122 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191389814 X:60119159-60119181 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191389964 X:60121215-60121237 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191390117 X:60123272-60123294 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191390272 X:60125328-60125350 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191390429 X:60127383-60127405 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191390583 X:60129440-60129462 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191390720 X:60131328-60131350 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191390876 X:60133385-60133407 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191391032 X:60135443-60135465 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191391183 X:60137499-60137521 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191391338 X:60139556-60139578 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191391492 X:60141614-60141636 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191391644 X:60143669-60143691 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191391797 X:60145726-60145748 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191391952 X:60147784-60147806 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191392105 X:60149840-60149862 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191392262 X:60151898-60151920 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191392416 X:60153955-60153977 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191392570 X:60156013-60156035 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191392720 X:60158071-60158093 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191392867 X:60160127-60160149 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191393015 X:60162183-60162205 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191393168 X:60164240-60164262 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191393320 X:60166297-60166319 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191393477 X:60168352-60168374 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191393632 X:60170409-60170431 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191393785 X:60172466-60172488 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191393942 X:60174523-60174545 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191394098 X:60176580-60176602 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191394250 X:60178637-60178659 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191394408 X:60180694-60180716 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191394562 X:60182752-60182774 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191394718 X:60184810-60184832 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191394870 X:60186868-60186890 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191395023 X:60188926-60188948 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191395176 X:60190984-60191006 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191395331 X:60193041-60193063 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191395486 X:60195098-60195120 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191395643 X:60197155-60197177 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191395799 X:60199213-60199235 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191395948 X:60201271-60201293 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191396098 X:60203329-60203351 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191396253 X:60205386-60205408 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191396411 X:60207444-60207466 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191396562 X:60209486-60209508 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191396708 X:60211542-60211564 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191396857 X:60213599-60213621 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191397004 X:60215656-60215678 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191397153 X:60217714-60217736 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191397306 X:60219771-60219793 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191397460 X:60221828-60221850 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191397614 X:60223885-60223907 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191397770 X:60225941-60225963 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191397925 X:60227998-60228020 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191398076 X:60230055-60230077 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191398230 X:60232112-60232134 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191398387 X:60234170-60234192 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191398541 X:60236226-60236248 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191398695 X:60238283-60238305 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191399004 X:60242399-60242421 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191399158 X:60244454-60244476 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191399312 X:60246511-60246533 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191399464 X:60248567-60248589 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191399616 X:60250624-60250646 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191399766 X:60252681-60252703 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191399983 X:60255589-60255611 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191400137 X:60257646-60257668 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191400290 X:60259703-60259725 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191400446 X:60261760-60261782 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191400598 X:60263817-60263839 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191400754 X:60265874-60265896 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191400909 X:60267931-60267953 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191401060 X:60269988-60270010 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191401208 X:60272045-60272067 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191401495 X:60275989-60276011 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191401644 X:60278045-60278067 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191401800 X:60280102-60280124 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191401954 X:60282159-60282181 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191402110 X:60284216-60284238 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191402268 X:60286274-60286296 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191402425 X:60288331-60288353 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191402556 X:60290047-60290069 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191402715 X:60292105-60292127 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191402874 X:60294164-60294186 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191403026 X:60296218-60296240 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191403180 X:60298277-60298299 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191403332 X:60300334-60300356 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191403642 X:60304449-60304471 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191403798 X:60306506-60306528 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191403951 X:60308563-60308585 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191404106 X:60310620-60310642 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191404259 X:60312677-60312699 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191404401 X:60314548-60314570 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191404553 X:60316605-60316627 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191404704 X:60318662-60318684 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191404856 X:60320719-60320741 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191405009 X:60322776-60322798 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191405147 X:60324660-60324682 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191405299 X:60326717-60326739 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191405452 X:60328774-60328796 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191405604 X:60330831-60330853 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191405750 X:60332716-60332738 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191405904 X:60334772-60334794 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191406058 X:60336829-60336851 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191406212 X:60338886-60338908 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191406364 X:60340941-60340963 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191406520 X:60342997-60343019 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191406674 X:60345054-60345076 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191406825 X:60347113-60347135 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191406983 X:60349170-60349192 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191407138 X:60351227-60351249 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191407288 X:60353284-60353306 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191407439 X:60355341-60355363 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191407592 X:60357396-60357418 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191407744 X:60359453-60359475 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191407892 X:60361512-60361534 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191408045 X:60363568-60363590 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191408197 X:60365626-60365648 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191408348 X:60367681-60367703 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191408507 X:60369738-60369760 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191408663 X:60371795-60371817 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191408960 X:60375906-60375928 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191409114 X:60377963-60377985 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191409264 X:60380020-60380042 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191409415 X:60382077-60382099 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191409565 X:60384138-60384160 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191409713 X:60386195-60386217 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191410016 X:60390309-60390331 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191410238 X:60393217-60393239 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191410391 X:60395274-60395296 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191410548 X:60397331-60397353 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191410701 X:60399388-60399410 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191410855 X:60401445-60401467 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191411010 X:60403502-60403524 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191411169 X:60405559-60405581 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191411322 X:60407616-60407638 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191411473 X:60409673-60409695 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191411622 X:60411729-60411751 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191411775 X:60413786-60413808 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191411920 X:60415843-60415865 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191412074 X:60417900-60417922 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191412227 X:60419957-60419979 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191412382 X:60422014-60422036 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191412536 X:60424071-60424093 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191412840 X:60428181-60428203 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191412993 X:60430238-60430260 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191413148 X:60432295-60432317 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191413305 X:60434352-60434374 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191413615 X:60438465-60438487 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191413768 X:60440522-60440544 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191413919 X:60442578-60442600 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191414073 X:60444636-60444658 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191414226 X:60446690-60446712 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191414539 X:60450804-60450826 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191414689 X:60452861-60452883 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191414843 X:60454918-60454940 CTCTTTCTGAGGGATCCGCAAGG + Intergenic
1191415000 X:60456975-60456997 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191415154 X:60459032-60459054 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191415307 X:60461092-60461114 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191415460 X:60463148-60463170 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191415615 X:60465206-60465228 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191415773 X:60467264-60467286 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191415930 X:60469314-60469336 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191416241 X:60473429-60473451 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191416400 X:60475485-60475507 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191416553 X:60477539-60477561 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191416707 X:60479598-60479620 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191416865 X:60481656-60481678 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191417019 X:60483714-60483736 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191417173 X:60485771-60485793 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191417484 X:60489884-60489906 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191417636 X:60491941-60491963 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191417791 X:60493998-60494020 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191417947 X:60496057-60496079 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191418100 X:60498114-60498136 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191418255 X:60500170-60500192 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191418408 X:60502227-60502249 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191418716 X:60506342-60506364 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191418871 X:60508401-60508423 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191419029 X:60510458-60510480 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191419179 X:60512515-60512537 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191419330 X:60514572-60514594 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191419488 X:60516630-60516652 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191419641 X:60518687-60518709 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191419797 X:60520748-60520770 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191419950 X:60522805-60522827 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191420100 X:60524862-60524884 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191420255 X:60526919-60526941 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191420408 X:60528976-60528998 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191420560 X:60531033-60531055 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191420712 X:60533090-60533112 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191420865 X:60535149-60535171 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191421020 X:60537206-60537228 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191421175 X:60539263-60539285 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191421333 X:60541320-60541342 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191421488 X:60543377-60543399 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191421639 X:60545434-60545456 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191421780 X:60547323-60547345 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191421937 X:60549380-60549402 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191422107 X:60551669-60551691 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191422263 X:60553726-60553748 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191422416 X:60555783-60555805 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191422570 X:60557844-60557866 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191422875 X:60561958-60561980 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191423178 X:60566072-60566094 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191423333 X:60568129-60568151 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191423479 X:60570186-60570208 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191423629 X:60572242-60572264 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191423784 X:60574299-60574321 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191423939 X:60576356-60576378 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191424091 X:60578413-60578435 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191424248 X:60580470-60580492 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191424402 X:60582527-60582549 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191424559 X:60584585-60584607 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191424714 X:60586639-60586661 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191424867 X:60588695-60588717 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191425020 X:60590751-60590773 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191425175 X:60592809-60592831 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191425327 X:60594867-60594889 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191425478 X:60596924-60596946 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191425629 X:60598981-60599003 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191425782 X:60601036-60601058 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191426091 X:60605152-60605174 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191426244 X:60607210-60607232 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191426400 X:60609267-60609289 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191426552 X:60611324-60611346 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191426705 X:60613381-60613403 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191426857 X:60615439-60615461 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191427008 X:60617496-60617518 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191427159 X:60619553-60619575 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191427315 X:60621610-60621632 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191427467 X:60623667-60623689 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191427614 X:60625727-60625749 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191427768 X:60627784-60627806 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191427925 X:60629841-60629863 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191428077 X:60631894-60631916 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191428231 X:60633952-60633974 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191428386 X:60636009-60636031 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191428534 X:60638062-60638084 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191428689 X:60640117-60640139 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191428843 X:60642174-60642196 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191428997 X:60644231-60644253 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191429151 X:60646288-60646310 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191429303 X:60648345-60648367 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191429457 X:60650403-60650425 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191429613 X:60652460-60652482 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191429758 X:60654517-60654539 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191430056 X:60658631-60658653 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191430208 X:60660689-60660711 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191430367 X:60662745-60662767 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191430523 X:60664802-60664824 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191430828 X:60668915-60668937 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191431126 X:60673031-60673053 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191431276 X:60675085-60675107 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191431428 X:60677142-60677164 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191431583 X:60679199-60679221 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191431734 X:60681256-60681278 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191431887 X:60683311-60683333 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191432041 X:60685368-60685390 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191432189 X:60687422-60687444 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191432491 X:60691536-60691558 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191432644 X:60693594-60693616 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191432796 X:60695651-60695673 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191432953 X:60697701-60697723 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191433109 X:60699758-60699780 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191433265 X:60701817-60701839 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191433400 X:60703533-60703555 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191433534 X:60705249-60705271 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191433687 X:60707306-60707328 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191433828 X:60709192-60709214 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191433984 X:60711252-60711274 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191434137 X:60713310-60713332 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191434291 X:60715367-60715389 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191434445 X:60717422-60717444 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191434599 X:60719477-60719499 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191434752 X:60721533-60721555 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191434906 X:60723590-60723612 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191435062 X:60725647-60725669 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191435215 X:60727704-60727726 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191435364 X:60729762-60729784 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191435521 X:60731820-60731842 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191435673 X:60733875-60733897 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191435825 X:60735931-60735953 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191435979 X:60737988-60738010 CTCTTTCTGAGGGATCCGCAAGG + Intergenic
1191436137 X:60740045-60740067 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191436296 X:60742103-60742125 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191436448 X:60744160-60744182 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191436597 X:60746217-60746239 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191436749 X:60748275-60748297 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191436903 X:60750332-60750354 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191437058 X:60752388-60752410 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191437211 X:60754446-60754468 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191437366 X:60756503-60756525 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191437516 X:60758562-60758584 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191437672 X:60760619-60760641 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191437977 X:60764735-60764757 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191438131 X:60766791-60766813 CTCTTTCTGGGGGATCCGCAAGG + Intergenic
1191438283 X:60768848-60768870 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191438441 X:60770906-60770928 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191438596 X:60772963-60772985 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191438750 X:60775019-60775041 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191438912 X:60777079-60777101 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191439066 X:60779136-60779158 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191439218 X:60781193-60781215 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191439371 X:60783250-60783272 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191439526 X:60785307-60785329 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191439750 X:60788555-60788577 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191439905 X:60790611-60790633 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191440061 X:60792668-60792690 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191440218 X:60794726-60794748 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191440372 X:60796783-60796805 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191440529 X:60798847-60798869 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191440689 X:60800905-60800927 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191440846 X:60802962-60802984 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191441002 X:60805021-60805043 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191441157 X:60807079-60807101 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191441313 X:60809137-60809159 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191441468 X:60811194-60811216 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191441624 X:60813252-60813274 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191441781 X:60815308-60815330 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191441934 X:60817361-60817383 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191442087 X:60819418-60819440 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191442237 X:60821475-60821497 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191442393 X:60823532-60823554 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191442544 X:60825589-60825611 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191442701 X:60827648-60827670 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191442854 X:60829707-60829729 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191443009 X:60831765-60831787 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191443167 X:60833823-60833845 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191443320 X:60835880-60835902 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191443481 X:60837939-60837961 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191443634 X:60839996-60840018 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191443785 X:60842053-60842075 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191443938 X:60844110-60844132 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191444090 X:60846168-60846190 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191444246 X:60848224-60848246 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191444399 X:60850281-60850303 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191444544 X:60852339-60852361 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191444697 X:60854397-60854419 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191444846 X:60856454-60856476 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191444997 X:60858511-60858533 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191445152 X:60860568-60860590 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191445300 X:60862625-60862647 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191445452 X:60864682-60864704 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191445608 X:60866738-60866760 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191445763 X:60868795-60868817 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191445920 X:60870854-60870876 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191446078 X:60872914-60872936 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191446232 X:60874971-60874993 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191446386 X:60877027-60877049 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191446541 X:60879084-60879106 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191446700 X:60881140-60881162 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191446857 X:60883197-60883219 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191447013 X:60885254-60885276 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191447167 X:60887311-60887333 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191447323 X:60889368-60889390 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191447477 X:60891426-60891448 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191447632 X:60893483-60893505 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191447785 X:60895540-60895562 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191447939 X:60897599-60897621 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191448091 X:60899656-60899678 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191448243 X:60901714-60901736 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191448395 X:60903771-60903793 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191448549 X:60905828-60905850 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191448702 X:60907885-60907907 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191448855 X:60909940-60909962 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191449005 X:60911997-60912019 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191449155 X:60914055-60914077 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191449304 X:60915942-60915964 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191449458 X:60917999-60918021 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191449612 X:60920056-60920078 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191449766 X:60922117-60922139 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191449917 X:60924176-60924198 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191450074 X:60926235-60926257 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191450378 X:60930350-60930372 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191450531 X:60932407-60932429 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191450685 X:60934468-60934490 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191450835 X:60936526-60936548 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191450990 X:60938583-60938605 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191451144 X:60940637-60940659 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191451296 X:60942694-60942716 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191451449 X:60944751-60944773 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191451606 X:60946807-60946829 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191451761 X:60948864-60948886 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191451916 X:60950925-60950947 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191452065 X:60952982-60953004 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191452216 X:60955040-60955062 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191452435 X:60957948-60957970 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191452592 X:60960005-60960027 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191452752 X:60962062-60962084 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191452905 X:60964119-60964141 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191453059 X:60966176-60966198 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191453208 X:60968234-60968256 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191453358 X:60970291-60970313 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191453513 X:60972348-60972370 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191453666 X:60974405-60974427 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191453822 X:60976462-60976484 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191453977 X:60978520-60978542 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191454131 X:60980578-60980600 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191454284 X:60982635-60982657 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191454437 X:60984692-60984714 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191454590 X:60986749-60986771 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191454745 X:60988805-60988827 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191454887 X:60990690-60990712 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191455042 X:60992747-60992769 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191455198 X:60994807-60994829 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191455351 X:60996864-60996886 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191455504 X:60998920-60998942 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191455659 X:61000975-61000997 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191455817 X:61003036-61003058 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191455975 X:61005094-61005116 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191456129 X:61007151-61007173 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191456283 X:61009208-61009230 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191456439 X:61011267-61011289 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191456592 X:61013326-61013348 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191456745 X:61015382-61015404 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191456897 X:61017439-61017461 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191457050 X:61019495-61019517 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191457201 X:61021549-61021571 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191457347 X:61023616-61023638 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191457491 X:61025671-61025693 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191457643 X:61027728-61027750 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191457796 X:61029784-61029806 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191457949 X:61031841-61031863 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191458104 X:61033898-61033920 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191458260 X:61035955-61035977 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191458407 X:61038013-61038035 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191458556 X:61040069-61040091 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191458710 X:61042125-61042147 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191458867 X:61044182-61044204 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191459023 X:61046239-61046261 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191459176 X:61048296-61048318 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191459330 X:61050353-61050375 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191459483 X:61052410-61052432 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191459637 X:61054467-61054489 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191459794 X:61056524-61056546 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191460096 X:61060639-61060661 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191460251 X:61062696-61062718 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191460409 X:61064753-61064775 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191460562 X:61066812-61066834 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191460714 X:61068868-61068890 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191460869 X:61070926-61070948 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191461177 X:61075042-61075064 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191461328 X:61077099-61077121 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191461481 X:61079156-61079178 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191461638 X:61081213-61081235 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191461791 X:61083270-61083292 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191461949 X:61085328-61085350 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191462101 X:61087383-61087405 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191462258 X:61089440-61089462 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191462418 X:61091497-61091519 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191462574 X:61093555-61093577 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191462731 X:61095612-61095634 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191462885 X:61097671-61097693 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191463035 X:61099727-61099749 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191463191 X:61101784-61101806 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191463345 X:61103841-61103863 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191463499 X:61105897-61105919 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191463653 X:61107954-61107976 CTCTTTCTGAGGGATCCGCAAGG + Intergenic
1191463815 X:61110011-61110033 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191463968 X:61112065-61112087 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191464119 X:61114122-61114144 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191464429 X:61118237-61118259 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191464578 X:61120296-61120318 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191464727 X:61122354-61122376 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191464886 X:61124414-61124436 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191465039 X:61126469-61126491 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191465191 X:61128524-61128546 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191465345 X:61130581-61130603 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191465496 X:61132639-61132661 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191465649 X:61134696-61134718 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191465802 X:61136753-61136775 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191465955 X:61138810-61138832 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191466167 X:61141718-61141740 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191466322 X:61143775-61143797 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191466473 X:61145831-61145853 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191466624 X:61147888-61147910 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191466776 X:61149944-61149966 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191466928 X:61152001-61152023 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191467087 X:61154058-61154080 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191467241 X:61156118-61156140 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191467546 X:61160233-61160255 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191467705 X:61162290-61162312 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191467858 X:61164348-61164370 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191468011 X:61166405-61166427 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191468163 X:61168462-61168484 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191468310 X:61170518-61170540 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191468464 X:61172575-61172597 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191468619 X:61174629-61174651 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191468774 X:61176686-61176708 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191468995 X:61179595-61179617 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191469293 X:61183710-61183732 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191469446 X:61185767-61185789 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191469602 X:61187824-61187846 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191469758 X:61189881-61189903 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191469912 X:61191938-61191960 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191470064 X:61193994-61194016 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191470215 X:61196052-61196074 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191470366 X:61198110-61198132 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191470524 X:61200167-61200189 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191470679 X:61202224-61202246 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191470834 X:61204281-61204303 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191471051 X:61207188-61207210 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191471205 X:61209246-61209268 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191471358 X:61211303-61211325 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191471534 X:61213536-61213558 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191471685 X:61215594-61215616 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191471836 X:61217651-61217673 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191471992 X:61219708-61219730 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191472142 X:61221765-61221787 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191472289 X:61223822-61223844 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191472442 X:61225879-61225901 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191472599 X:61227936-61227958 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191472751 X:61229993-61230015 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191472906 X:61232051-61232073 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191473058 X:61234108-61234130 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191473209 X:61236167-61236189 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191473512 X:61240280-61240302 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191473653 X:61242166-61242188 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191473809 X:61244223-61244245 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191473965 X:61246280-61246302 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191474120 X:61248337-61248359 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191474276 X:61250394-61250416 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191474430 X:61252451-61252473 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191474580 X:61254508-61254530 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191474734 X:61256564-61256586 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191474890 X:61258621-61258643 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191475044 X:61260676-61260698 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191475192 X:61262733-61262755 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191475339 X:61264791-61264813 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191475495 X:61266848-61266870 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191475648 X:61268906-61268928 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191475798 X:61270960-61270982 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191475949 X:61273017-61273039 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191476099 X:61275074-61275096 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191476255 X:61277132-61277154 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191476405 X:61279189-61279211 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191476555 X:61281245-61281267 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191476711 X:61283303-61283325 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191476866 X:61285361-61285383 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191477025 X:61287418-61287440 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191477179 X:61289476-61289498 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191477334 X:61291536-61291558 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191477486 X:61293594-61293616 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191477639 X:61295653-61295675 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191477787 X:61297540-61297562 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191477936 X:61299598-61299620 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191478093 X:61301656-61301678 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191478249 X:61303711-61303733 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191478401 X:61305766-61305788 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191478552 X:61307821-61307843 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191478703 X:61309878-61309900 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191478855 X:61311936-61311958 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191479015 X:61313994-61314016 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191479169 X:61316051-61316073 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191479327 X:61318108-61318130 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191479484 X:61320167-61320189 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191479642 X:61322228-61322250 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191479802 X:61324283-61324305 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191479957 X:61326343-61326365 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191480112 X:61328400-61328422 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191480264 X:61330457-61330479 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191480419 X:61332514-61332536 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191480560 X:61334402-61334424 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191480712 X:61336458-61336480 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191481016 X:61340572-61340594 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191481173 X:61342629-61342651 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191481326 X:61344686-61344708 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191481629 X:61348800-61348822 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191481779 X:61350857-61350879 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191481929 X:61352915-61352937 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191482080 X:61354974-61354996 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191482235 X:61357031-61357053 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191482367 X:61358747-61358769 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191482521 X:61360804-61360826 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191482680 X:61362861-61362883 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191482842 X:61364918-61364940 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191482999 X:61366975-61366997 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191483282 X:61370924-61370946 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191483436 X:61372984-61373006 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191483591 X:61375041-61375063 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191483743 X:61377096-61377118 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191483896 X:61379153-61379175 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191484049 X:61381207-61381229 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191484200 X:61383264-61383286 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191484356 X:61385321-61385343 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191484508 X:61387378-61387400 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191484661 X:61389437-61389459 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191484813 X:61391496-61391518 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191484963 X:61393553-61393575 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191485115 X:61395610-61395632 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191485271 X:61397667-61397689 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191485430 X:61399727-61399749 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191485581 X:61401784-61401806 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191485876 X:61405898-61405920 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191486024 X:61407955-61407977 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191486176 X:61410012-61410034 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191486326 X:61412069-61412091 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191486484 X:61414127-61414149 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191486637 X:61416184-61416206 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191486780 X:61418070-61418092 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191486934 X:61420127-61420149 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191487085 X:61422184-61422206 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191487240 X:61424241-61424263 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191487396 X:61426299-61426321 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191487549 X:61428358-61428380 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191487703 X:61430415-61430437 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191487855 X:61432473-61432495 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191488010 X:61434530-61434552 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191488165 X:61436587-61436609 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191488322 X:61438646-61438668 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191488477 X:61440703-61440725 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191488636 X:61442760-61442782 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191488789 X:61444817-61444839 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191488943 X:61446874-61446896 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191489220 X:61450648-61450670 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191489375 X:61452706-61452728 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191489682 X:61456823-61456845 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191489835 X:61458879-61458901 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191489993 X:61460936-61460958 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191490145 X:61462993-61463015 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191490296 X:61465051-61465073 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191490449 X:61467109-61467131 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191490595 X:61469168-61469190 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191490745 X:61471224-61471246 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191490897 X:61473278-61473300 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191491055 X:61475338-61475360 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191491211 X:61477399-61477421 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191491365 X:61479456-61479478 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191491520 X:61481512-61481534 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191491830 X:61485626-61485648 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191491982 X:61487687-61487709 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191492137 X:61489744-61489766 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191492294 X:61491801-61491823 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191492444 X:61493859-61493881 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191492598 X:61495916-61495938 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191492748 X:61497973-61497995 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191492904 X:61500030-61500052 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191493060 X:61502087-61502109 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191493221 X:61504145-61504167 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191493375 X:61506203-61506225 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191493530 X:61508260-61508282 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191493683 X:61510319-61510341 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191493826 X:61512207-61512229 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191493981 X:61514264-61514286 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191494134 X:61516319-61516341 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191494266 X:61518036-61518058 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191494424 X:61520093-61520115 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191494576 X:61522152-61522174 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191494728 X:61524209-61524231 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191494881 X:61526266-61526288 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191495022 X:61528128-61528150 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191495177 X:61530183-61530205 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191495329 X:61532242-61532264 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191495482 X:61534299-61534321 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191495634 X:61536355-61536377 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191495767 X:61538071-61538093 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191495919 X:61540128-61540150 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191496076 X:61542185-61542207 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191496229 X:61544241-61544263 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191496381 X:61546298-61546320 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191496539 X:61548355-61548377 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191496695 X:61550411-61550433 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191496849 X:61552468-61552490 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191497002 X:61554525-61554547 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191497160 X:61556585-61556607 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191497312 X:61558638-61558660 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191497463 X:61560695-61560717 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191497618 X:61562752-61562774 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191497766 X:61564809-61564831 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191497897 X:61566525-61566547 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191498052 X:61568580-61568602 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191498204 X:61570637-61570659 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191498356 X:61572694-61572716 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191498512 X:61574753-61574775 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191498666 X:61576809-61576831 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191498820 X:61578870-61578892 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191498972 X:61580926-61580948 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191499124 X:61582984-61583006 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191499278 X:61585041-61585063 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191499433 X:61587096-61587118 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191499589 X:61589154-61589176 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191499743 X:61591211-61591233 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191499898 X:61593270-61593292 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191500049 X:61595330-61595352 CTCTTTCTGTGGGATCCCCAAGG + Intergenic
1191500207 X:61597393-61597415 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191500365 X:61599450-61599472 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191500519 X:61601507-61601529 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191500669 X:61603564-61603586 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191500823 X:61605621-61605643 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191500977 X:61607677-61607699 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191501136 X:61609731-61609753 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191501294 X:61611786-61611808 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191501446 X:61613841-61613863 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191501602 X:61615898-61615920 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191501758 X:61617955-61617977 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191501912 X:61620013-61620035 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191502065 X:61622071-61622093 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191502201 X:61623787-61623809 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191502358 X:61625844-61625866 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191502511 X:61627903-61627925 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191502663 X:61629960-61629982 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191502817 X:61632018-61632040 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191502972 X:61634075-61634097 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191503127 X:61636132-61636154 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191503282 X:61638188-61638210 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191503434 X:61640245-61640267 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191503589 X:61642304-61642326 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191503742 X:61644361-61644383 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191503892 X:61646421-61646443 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191504046 X:61648477-61648499 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191504204 X:61650536-61650558 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191504353 X:61652592-61652614 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191504500 X:61654649-61654671 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191504803 X:61658764-61658786 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191504959 X:61660822-61660844 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191505114 X:61662879-61662901 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191505271 X:61664938-61664960 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191505425 X:61666994-61667016 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191505581 X:61669051-61669073 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191505738 X:61671108-61671130 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191505894 X:61673165-61673187 CTCTTTCTGAGGGATCCGCAAGG + Intergenic
1191506048 X:61675220-61675242 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191506200 X:61677277-61677299 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191506351 X:61679335-61679357 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191506506 X:61681393-61681415 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191506661 X:61683446-61683468 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191506820 X:61685502-61685524 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191506969 X:61687559-61687581 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191507117 X:61689616-61689638 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191507273 X:61691673-61691695 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191507572 X:61695785-61695807 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191507726 X:61697843-61697865 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191508194 X:61704011-61704033 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191508348 X:61706068-61706090 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191508502 X:61708126-61708148 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191508659 X:61710184-61710206 CTCTTTCTGGGGGATCCGCAAGG + Intergenic
1191508810 X:61712241-61712263 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191508964 X:61714298-61714320 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191509121 X:61716355-61716377 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191509277 X:61718412-61718434 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191509426 X:61720441-61720463 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191509578 X:61722498-61722520 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191509731 X:61724555-61724577 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191509886 X:61726612-61726634 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191510043 X:61728669-61728691 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191510345 X:61732783-61732805 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191510499 X:61734840-61734862 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191510806 X:61738954-61738976 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191510956 X:61741011-61741033 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191511108 X:61743068-61743090 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191511259 X:61745126-61745148 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191511412 X:61747183-61747205 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191511564 X:61749240-61749262 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191511852 X:61753182-61753204 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191512008 X:61755241-61755263 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191512160 X:61757299-61757321 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191512312 X:61759356-61759378 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191512465 X:61761414-61761436 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191512618 X:61763472-61763494 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191512771 X:61765528-61765550 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191512921 X:61767585-61767607 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191513077 X:61769644-61769666 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191513228 X:61771701-61771723 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191513386 X:61773758-61773780 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191513689 X:61777872-61777894 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191513847 X:61779929-61779951 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191514000 X:61781986-61782008 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191514285 X:61785759-61785781 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191514441 X:61787817-61787839 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191514595 X:61789874-61789896 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191514746 X:61791931-61791953 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191514898 X:61793988-61794010 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191515046 X:61796045-61796067 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191515201 X:61798103-61798125 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191515357 X:61800162-61800184 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191515511 X:61802221-61802243 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191515663 X:61804278-61804300 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191515804 X:61806164-61806186 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191515954 X:61808221-61808243 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191516109 X:61810278-61810300 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191516264 X:61812335-61812357 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191516415 X:61814392-61814414 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191516571 X:61816447-61816469 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191516727 X:61818504-61818526 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191516879 X:61820562-61820584 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191517188 X:61824676-61824698 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191517344 X:61826734-61826756 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191517500 X:61828796-61828818 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191517653 X:61830853-61830875 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191517809 X:61832912-61832934 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191517961 X:61834969-61834991 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191518115 X:61837027-61837049 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191518268 X:61839084-61839106 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191518424 X:61841140-61841162 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191518576 X:61843196-61843218 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191518732 X:61845253-61845275 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191518884 X:61847310-61847332 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191519042 X:61849371-61849393 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191519199 X:61851429-61851451 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191519352 X:61853486-61853508 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191519504 X:61855542-61855564 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191519661 X:61857598-61857620 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191519816 X:61859655-61859677 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191519972 X:61861714-61861736 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191520124 X:61863771-61863793 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191520278 X:61865827-61865849 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191520576 X:61869940-61869962 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191520732 X:61871994-61872016 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191520888 X:61874050-61874072 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191521044 X:61876108-61876130 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191521199 X:61878165-61878187 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191521334 X:61879881-61879903 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191521647 X:61883990-61884012 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191521804 X:61886048-61886070 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191521959 X:61888105-61888127 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191522113 X:61890161-61890183 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191522267 X:61892220-61892242 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191522418 X:61894277-61894299 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191522565 X:61896337-61896359 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191522704 X:61898223-61898245 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191522858 X:61900281-61900303 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191523007 X:61902337-61902359 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191523160 X:61904393-61904415 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191523313 X:61906451-61906473 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191523460 X:61908508-61908530 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191523615 X:61910565-61910587 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191523770 X:61912623-61912645 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191523920 X:61914680-61914702 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191524076 X:61916736-61916758 CTCTTTCTGAGGGATCCGCAAGG + Intergenic
1191524232 X:61918795-61918817 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191524385 X:61920852-61920874 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191524536 X:61922910-61922932 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191524689 X:61924966-61924988 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191524836 X:61927022-61927044 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191524990 X:61929079-61929101 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191525148 X:61931137-61931159 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191525298 X:61933197-61933219 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191525450 X:61935254-61935276 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191525606 X:61937312-61937334 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191525761 X:61939370-61939392 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191525914 X:61941427-61941449 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191526070 X:61943484-61943506 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191526229 X:61945542-61945564 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191526384 X:61947599-61947621 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191526519 X:61949488-61949510 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191526673 X:61951545-61951567 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191526830 X:61953603-61953625 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191526984 X:61955659-61955681 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191527140 X:61957719-61957741 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191527288 X:61959776-61959798 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191527444 X:61961834-61961856 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191527596 X:61963892-61963914 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191527749 X:61965947-61965969 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191527905 X:61968005-61968027 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191528055 X:61970065-61970087 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191528208 X:61972124-61972146 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191528506 X:61976069-61976091 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191528657 X:61978125-61978147 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191528812 X:61980181-61980203 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191528965 X:61982235-61982257 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191529124 X:61984292-61984314 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191529277 X:61986349-61986371 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191529405 X:61988065-61988087 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191529560 X:61990124-61990146 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191529715 X:61992181-61992203 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191529868 X:61994238-61994260 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191529999 X:61995954-61995976 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191530126 X:61997670-61997692 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191530278 X:61999728-61999750 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191530432 X:62001785-62001807 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191530586 X:62003842-62003864 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191530740 X:62005901-62005923 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191530895 X:62007955-62007977 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191531050 X:62010015-62010037 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191531206 X:62012071-62012093 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191531362 X:62014127-62014149 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191531519 X:62016185-62016207 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191531679 X:62018242-62018264 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191531835 X:62020299-62020321 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191531989 X:62022356-62022378 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191532143 X:62024413-62024435 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191532300 X:62026470-62026492 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191532453 X:62028529-62028551 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191532602 X:62030586-62030608 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191532757 X:62032643-62032665 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191532910 X:62034702-62034724 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191533063 X:62036759-62036781 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191533218 X:62038817-62038839 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191533373 X:62040874-62040896 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191533530 X:62042932-62042954 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191533656 X:62044648-62044670 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191533812 X:62046705-62046727 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191533961 X:62048761-62048783 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191534118 X:62050818-62050840 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191534273 X:62052872-62052894 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191534426 X:62054928-62054950 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191534582 X:62056985-62057007 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191534740 X:62059042-62059064 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191534891 X:62061099-62061121 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191535037 X:62063156-62063178 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191535190 X:62065215-62065237 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191535345 X:62067272-62067294 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191535515 X:62069561-62069583 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191535822 X:62073678-62073700 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191535974 X:62075737-62075759 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191536129 X:62077794-62077816 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191536281 X:62079849-62079871 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191536438 X:62081906-62081928 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191536593 X:62083968-62083990 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191536748 X:62086025-62086047 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191536905 X:62088082-62088104 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191537059 X:62090139-62090161 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191537211 X:62092196-62092218 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191537362 X:62094253-62094275 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191537512 X:62096310-62096332 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191537665 X:62098368-62098390 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191537820 X:62100423-62100445 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191537971 X:62102480-62102502 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191538122 X:62104540-62104562 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191538274 X:62106598-62106620 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191538437 X:62108855-62108877 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191538591 X:62110912-62110934 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191538743 X:62112968-62112990 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191538897 X:62115024-62115046 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191539051 X:62117081-62117103 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191539207 X:62119136-62119158 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191539361 X:62121193-62121215 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191539515 X:62123249-62123271 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191539666 X:62125307-62125329 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191539820 X:62127364-62127386 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191539973 X:62129421-62129443 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191540126 X:62131478-62131500 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191540281 X:62133536-62133558 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191540435 X:62135593-62135615 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191540585 X:62137650-62137672 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191540737 X:62139707-62139729 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191540893 X:62141764-62141786 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191541050 X:62143821-62143843 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191541202 X:62145878-62145900 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191541355 X:62147935-62147957 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191541505 X:62149991-62150013 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191541655 X:62152049-62152071 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191541808 X:62154108-62154130 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191541964 X:62156168-62156190 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191542122 X:62158226-62158248 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191542282 X:62160283-62160305 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191542434 X:62162340-62162362 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191542587 X:62164398-62164420 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191542738 X:62166457-62166479 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191542892 X:62168514-62168536 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191543044 X:62170575-62170597 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191543199 X:62172633-62172655 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191543352 X:62174691-62174713 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191543510 X:62176747-62176769 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191543665 X:62178803-62178825 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191543819 X:62180860-62180882 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191543975 X:62182918-62182940 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191544133 X:62184976-62184998 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191544444 X:62189091-62189113 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191544594 X:62191147-62191169 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191544744 X:62193205-62193227 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191544894 X:62195262-62195284 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191545046 X:62197319-62197341 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191545201 X:62199379-62199401 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191545356 X:62201436-62201458 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191545510 X:62203494-62203516 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191545667 X:62205551-62205573 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191545814 X:62207608-62207630 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191545964 X:62209496-62209518 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191546119 X:62211553-62211575 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191546424 X:62215669-62215691 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191546574 X:62217726-62217748 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191546728 X:62219785-62219807 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191546884 X:62221842-62221864 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191547042 X:62223899-62223921 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191547193 X:62225957-62225979 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191547346 X:62228014-62228036 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191547656 X:62232128-62232150 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191547807 X:62234184-62234206 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191547961 X:62236241-62236263 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191548113 X:62238283-62238305 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191548267 X:62240340-62240362 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191548421 X:62242398-62242420 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191548573 X:62244457-62244479 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191548726 X:62246514-62246536 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191548879 X:62248572-62248594 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191549031 X:62250630-62250652 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191549185 X:62252688-62252710 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191549339 X:62254745-62254767 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191549496 X:62256802-62256824 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191549650 X:62258859-62258881 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191549803 X:62260915-62260937 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191549955 X:62262970-62262992 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191550113 X:62265027-62265049 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191550266 X:62267084-62267106 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191550422 X:62269141-62269163 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191550575 X:62271198-62271220 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191550727 X:62273255-62273277 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191550880 X:62275312-62275334 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191551032 X:62277370-62277392 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191551188 X:62279427-62279449 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191551345 X:62281486-62281508 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191551501 X:62283543-62283565 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191551653 X:62285602-62285624 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191551805 X:62287659-62287681 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191551956 X:62289716-62289738 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191552108 X:62291772-62291794 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191552261 X:62293829-62293851 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191552415 X:62295886-62295908 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191552570 X:62297943-62297965 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191552724 X:62299999-62300021 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191552878 X:62302058-62302080 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191553033 X:62304115-62304137 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191553187 X:62306172-62306194 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191553332 X:62308059-62308081 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191553493 X:62310115-62310137 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191553649 X:62312172-62312194 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191553802 X:62314229-62314251 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191553955 X:62316288-62316310 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191554111 X:62318345-62318367 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191554269 X:62320403-62320425 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191554420 X:62322460-62322482 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191554570 X:62324516-62324538 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191554722 X:62326574-62326596 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191554878 X:62328631-62328653 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191555028 X:62330688-62330710 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191555182 X:62332745-62332767 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191555336 X:62334802-62334824 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191555484 X:62336858-62336880 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191555634 X:62338912-62338934 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191555787 X:62340969-62340991 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191555941 X:62343025-62343047 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191556072 X:62344740-62344762 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191556228 X:62346797-62346819 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191556383 X:62348853-62348875 CTCTTTCTGTGGGATCCACAAGG + Intergenic
1191556533 X:62350910-62350932 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191556689 X:62352967-62352989 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191556846 X:62355024-62355046 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191557000 X:62357079-62357101 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191557154 X:62359140-62359162 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191557309 X:62361197-62361219 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191557465 X:62363254-62363276 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191557616 X:62365311-62365333 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191557772 X:62367365-62367387 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191557927 X:62369421-62369443 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191558085 X:62371479-62371501 CTCTTTCTGTGGGATCCGCAGGG + Intergenic
1191558238 X:62373536-62373558 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191558393 X:62375591-62375613 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191558542 X:62377648-62377670 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191558697 X:62379706-62379728 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191558849 X:62381763-62381785 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191559003 X:62383821-62383843 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191559158 X:62385879-62385901 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191559314 X:62387936-62387958 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191559468 X:62389993-62390015 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191559625 X:62392050-62392072 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191559778 X:62394108-62394130 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191559931 X:62396165-62396187 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191560083 X:62398223-62398245 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191560237 X:62400282-62400304 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191560394 X:62402340-62402362 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191560701 X:62406455-62406477 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191560854 X:62408512-62408534 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191561005 X:62410568-62410590 CTCTTTCTGTGGGATCCGCAAGG + Intergenic
1191561221 X:62463434-62463456 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191561377 X:62465491-62465513 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191561525 X:62467549-62467571 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191561685 X:62469606-62469628 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191561843 X:62471662-62471684 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191562001 X:62473718-62473740 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191562315 X:62477831-62477853 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191562470 X:62479888-62479910 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191562623 X:62481945-62481967 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191562930 X:62486058-62486080 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191563238 X:62490172-62490194 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191563391 X:62492229-62492251 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191563545 X:62494286-62494308 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191563702 X:62496343-62496365 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191563855 X:62498400-62498422 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191564162 X:62502512-62502534 CTCTTTCTGTGGGATCCGCAAGG - Intergenic
1191564306 X:62504567-62504589 CTCTTTCTGTGGGATCCACAAGG - Intergenic
1192437443 X:71151698-71151720 CACTTTCAGAGGGATTCACAAGG + Intronic
1193649195 X:84109396-84109418 CTCTGGTGGTGGGATTCCCATGG - Intronic
1195200689 X:102547421-102547443 GTATTTCAGGGGGAGTCCCATGG + Intergenic
1200779862 Y:7204945-7204967 CTGTTTCTGGGGAATTTCCAGGG - Intergenic
1201947747 Y:19530260-19530282 CTGTTTCTGGGGAATTCTCAGGG - Intergenic