ID: 1062046925

View in Genome Browser
Species Human (GRCh38)
Location 9:134428620-134428642
Sequence CCTCTTTCGGGGGGATTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062046925_1062046936 24 Left 1062046925 9:134428620-134428642 CCTGGGAATCCCCCCGAAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046925_1062046933 8 Left 1062046925 9:134428620-134428642 CCTGGGAATCCCCCCGAAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046925_1062046937 27 Left 1062046925 9:134428620-134428642 CCTGGGAATCCCCCCGAAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1062046937 9:134428670-134428692 TTGGATAACCTGCTGTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062046925 Original CRISPR CCTCTTTCGGGGGGATTCCC AGG (reversed) Intronic
901010428 1:6198876-6198898 CCTCTTTTGTTGGGACTCCCTGG - Intronic
921444802 1:215233021-215233043 TCTGTTTTGGGGGGACTCCCAGG - Intronic
1067286133 10:44908750-44908772 CCTCTTATGGGGGCAGTCCCAGG + Intergenic
1073424079 10:103445832-103445854 CCTCTTCCAGGGGAGTTCCCTGG + Exonic
1075341167 10:121647939-121647961 CCTCTTTCTGGGGGAGACCAGGG - Intergenic
1076180620 10:128404644-128404666 GGTCTTTCAGTGGGATTCCCTGG + Intergenic
1076449749 10:130548721-130548743 GCTCTATTCGGGGGATTCCCTGG + Intergenic
1077156277 11:1093121-1093143 GCTCTTTCGGGGGCAGGCCCCGG + Intergenic
1091566664 12:1653856-1653878 CCTCTTTCAGGTGGATTTCTGGG + Intergenic
1092743042 12:11649010-11649032 CGTCGGGCGGGGGGATTCCCGGG - Intergenic
1094486489 12:30929580-30929602 CCTCTATTGGGGGTGTTCCCAGG + Intronic
1096579512 12:52575398-52575420 CCTGTCTCGGGGGGCTTTCCCGG + Intergenic
1104718017 12:131029536-131029558 CCTCGTTCGGTGACATTCCCAGG + Intronic
1104718063 12:131029715-131029737 CCTCGTTCGGTGACATTCCCAGG + Intronic
1104718098 12:131029851-131029873 CCTCGTTCGGTGACATTCCCAGG + Intronic
1104718109 12:131029896-131029918 CCTCGTTCGGTGACATTCCCAGG + Intronic
1104730221 12:131101243-131101265 CATCTCTTGGGGGGCTTCCCAGG + Intronic
1108498045 13:51044392-51044414 CCTGTCTTGGGGGGACTCCCAGG - Intergenic
1112206849 13:97332849-97332871 CCTCTTTGGGGAGGATAACCAGG - Intronic
1113084769 13:106556932-106556954 CTTATTTTGGGGGGATTCTCAGG - Intronic
1117600336 14:57367382-57367404 CCTTTTGCGGGGGGTTCCCCAGG - Intergenic
1120662993 14:87272712-87272734 ACTCTTTCGGGGGGAAACCATGG + Intergenic
1124931747 15:34126728-34126750 CCTGTTTCCTGAGGATTCCCAGG - Intergenic
1124951514 15:34326221-34326243 CCTCTTTGGTTGGGATTCTCAGG - Intronic
1129659025 15:77542858-77542880 CCTCCTTCAGGAGGCTTCCCTGG + Intergenic
1132615038 16:836274-836296 CCTCTGTGGGGGGGGTTACCTGG - Intergenic
1138889195 16:61121652-61121674 ACTCTTTCGGGTGGTGTCCCAGG + Intergenic
1141831616 16:86512421-86512443 CCTCTCTGCGGGGGACTCCCCGG + Intronic
1146206077 17:30906552-30906574 CCTCCTTCGTGGAGACTCCCTGG + Exonic
1148967265 17:51446657-51446679 CCTTATACAGGGGGATTCCCAGG + Intergenic
1150069777 17:62140576-62140598 CTTCTTTGGCGGGGAGTCCCGGG + Intergenic
1152111192 17:78358605-78358627 GCTCTTCTGGGGGGACTCCCAGG + Exonic
1157362822 18:47034678-47034700 CCTCTTCCGGGTTGCTTCCCGGG + Exonic
1157586781 18:48806109-48806131 CCTCTTTAGGGAGGCTTCCCTGG - Intronic
1161136379 19:2622467-2622489 CCAGTTTCGGGGGCTTTCCCTGG - Intronic
926235974 2:11044274-11044296 CCTCTTTGGTGGGCGTTCCCAGG + Intergenic
931440848 2:62289310-62289332 CCTCTCTCGGGAGGGTTCCAGGG - Intergenic
932413116 2:71558813-71558835 CCTCTCTGGGGGGGAATTCCAGG + Intronic
935089874 2:99884886-99884908 CCTCTACCTGGGGGATTCACTGG + Intronic
935740183 2:106140507-106140529 CCTCTTTAGGGTGGGTGCCCAGG + Intronic
941087497 2:161134757-161134779 CCTCCTTCGGAGGGAGACCCAGG - Intergenic
943112453 2:183622408-183622430 CCTTATACAGGGGGATTCCCAGG - Intergenic
1173790981 20:45827553-45827575 CCTCGGTCGGGGGGACTCCAAGG - Intronic
1177207710 21:18029647-18029669 CCTGTTTTGGGGGGAATCTCAGG + Intronic
1185372654 22:50468222-50468244 CCTCTGTCGGGGGGTTTGACCGG - Intronic
965373735 3:167895941-167895963 CCTCTTTTGGGGGTCTTCCACGG - Intergenic
968008111 3:195256516-195256538 CCTCTTTCTGGGATAATCCCTGG - Intronic
969568161 4:7992445-7992467 CCTCCTTCTCGGGGATGCCCTGG - Intronic
975307498 4:72866487-72866509 CCTCTTTCCAGGAGATTCCCAGG + Intergenic
977031129 4:91885000-91885022 TCTCCTTCAGGGGGAGTCCCTGG - Intergenic
977765753 4:100795930-100795952 CCTCCTTTGGGGGGCTTCCTGGG - Intronic
982641673 4:157969443-157969465 CCTTTTTCAGGGGAATTCGCAGG - Intergenic
985553799 5:546364-546386 CCTCTTTCCCGGGCCTTCCCAGG - Intergenic
986119358 5:4817248-4817270 GCTCTTTAGGGGGAAATCCCAGG + Intergenic
997779302 5:136640871-136640893 GCTCTTTCAAGGGGATGCCCAGG - Intergenic
998979096 5:147681231-147681253 CCTCTTTAAGGGGGACTGCCAGG + Intronic
999189373 5:149735201-149735223 CCACTTTCATTGGGATTCCCTGG + Intronic
1007661678 6:43490592-43490614 CCTGGTTCTGGGGAATTCCCTGG + Intronic
1012833373 6:104233597-104233619 CCTCTTTTGGGGAGACACCCTGG - Intergenic
1019908990 7:4086883-4086905 TATCTTTGGGGGAGATTCCCAGG + Intronic
1020180600 7:5919482-5919504 CCTCTCTCGGGGGGGTTCTGAGG + Intronic
1020255027 7:6498120-6498142 CTTCTTTGGGGAGGATTCCAAGG - Exonic
1020302329 7:6805400-6805422 CCTCTCTCGGGGGGGTTCTGAGG - Intronic
1024112677 7:46162853-46162875 GCTCTTTAAGGGGAATTCCCTGG + Intergenic
1031968045 7:128042308-128042330 CCTCTTGGGGAGGGATCCCCAGG - Intronic
1035890000 8:3332969-3332991 CCTCTTTCAAGGGCTTTCCCTGG - Intronic
1044890720 8:96832649-96832671 CTTCTTTAGGGAGCATTCCCTGG - Intronic
1051843880 9:21429952-21429974 CCTCTTGAGGGGTGCTTCCCAGG - Intronic
1053532849 9:38899034-38899056 CATCTCTCGAGTGGATTCCCTGG + Intergenic
1054205075 9:62123463-62123485 CATCTCTCGAGTGGATTCCCTGG + Intergenic
1054633284 9:67464907-67464929 CATCTCTCGAGTGGATTCCCTGG - Intergenic
1059080592 9:111245009-111245031 TCTCTTTAGGGTGAATTCCCAGG - Intergenic
1061492282 9:130952361-130952383 CTTCCTTAGGGTGGATTCCCAGG + Intergenic
1062046925 9:134428620-134428642 CCTCTTTCGGGGGGATTCCCAGG - Intronic
1185691712 X:2160557-2160579 CCTCTTACGGGAGGCTGCCCTGG - Intergenic
1190666695 X:52702577-52702599 TCACCTTCGGGGAGATTCCCTGG + Exonic
1190672723 X:52755831-52755853 TCACCTTCGGGGAGATTCCCTGG - Exonic
1192076836 X:68007573-68007595 CCTCTTACTGGGACATTCCCTGG + Intergenic