ID: 1062046928

View in Genome Browser
Species Human (GRCh38)
Location 9:134428629-134428651
Sequence GAGCCGCAGCCTCTTTCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062046928_1062046936 15 Left 1062046928 9:134428629-134428651 CCCCCCGAAAGAGGCTGCGGCTC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046928_1062046933 -1 Left 1062046928 9:134428629-134428651 CCCCCCGAAAGAGGCTGCGGCTC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046928_1062046937 18 Left 1062046928 9:134428629-134428651 CCCCCCGAAAGAGGCTGCGGCTC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1062046937 9:134428670-134428692 TTGGATAACCTGCTGTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062046928 Original CRISPR GAGCCGCAGCCTCTTTCGGG GGG (reversed) Intronic
905514428 1:38551570-38551592 GAGTCTCTGCCTCTATCGGGAGG - Intergenic
906888300 1:49677098-49677120 GAGCAATAGCCTCTTTTGGGAGG - Intronic
919689914 1:200520086-200520108 GAAACGCAGCCTCTTCTGGGGGG + Intergenic
1066007319 10:31157674-31157696 CAGCCTCAGCCTCCTTCTGGCGG + Intergenic
1073045586 10:100635931-100635953 GAGCTGCAGCCCCTTTCAGCTGG - Intergenic
1075684907 10:124357089-124357111 GAGCCGCACCCTCTTGGGGCTGG - Intergenic
1075759780 10:124847127-124847149 GATCCCCAGCCTCCTTCGTGGGG - Intergenic
1076192088 10:128490103-128490125 GAGCAGCTGCCTCTTTCCGCTGG - Intergenic
1076373968 10:129971556-129971578 GAGCTGCAGCCTTTTGTGGGGGG + Intergenic
1076771360 10:132667213-132667235 AAGCCGCAGCCCCTTTTGGTTGG + Intronic
1077321146 11:1942615-1942637 GGGCCGCAGGCTGTTTGGGGGGG + Intergenic
1085296680 11:75435351-75435373 CAGCCGCAGCCTCTCTTGAGGGG - Exonic
1090364359 11:126193317-126193339 GAGCCGCGTCCTCTTTCAGCAGG - Intergenic
1105545030 13:21344957-21344979 GGGCTGCAGCCTCCTTCTGGAGG + Intergenic
1105813897 13:24016283-24016305 GAGCCGCAGCTGCTTCCTGGAGG - Intronic
1107559684 13:41547868-41547890 TCCCCGCAGCCTCTTTAGGGTGG - Intergenic
1113848611 13:113405630-113405652 GGGCCGCAGCATCCTCCGGGTGG + Intergenic
1115641815 14:35340102-35340124 GAGCAGCAGCCTCCTTCCAGGGG + Intergenic
1119106873 14:71932811-71932833 GACCGGCAGCCTCTTGGGGGCGG - Exonic
1123981656 15:25610235-25610257 GAGCCACAGCCTCTGTGTGGAGG - Intergenic
1129695580 15:77739059-77739081 GAGCCGCAGACTCCCTGGGGTGG - Intronic
1133215238 16:4288344-4288366 GAACCATAGCCTCTTTGGGGTGG + Intergenic
1139402952 16:66696677-66696699 GAGCCGCAGCCGCAGCCGGGCGG - Exonic
1139650571 16:68360115-68360137 GAGCCGCAGCCCCACCCGGGGGG + Exonic
1141481132 16:84307738-84307760 GCGCCCCAGCCTCCTTCGGAGGG - Intronic
1151696610 17:75721294-75721316 GAGCCGCAGCCCTTTCCGGGGGG + Intergenic
1151707687 17:75779369-75779391 GAGCGGCAGCCTCCCCCGGGAGG + Intronic
1159558281 18:69967591-69967613 GAGCCGCAGCATCGTCCTGGAGG - Intergenic
1166380203 19:42351599-42351621 GAGCCCCAGCCCCTTGCCGGTGG - Intronic
1168447317 19:56431450-56431472 CAGCCCCAGCCTCTTTCTGCTGG - Intronic
925148889 2:1601143-1601165 GAGCCTCAGCCACCTTTGGGTGG - Intergenic
928442590 2:31304414-31304436 GAGCCCCAGCCCCTCTCCGGGGG - Intergenic
931866102 2:66413434-66413456 GAGGGGTAGCCTCCTTCGGGTGG - Intergenic
933743147 2:85550708-85550730 GAGCTGCAGCCTCTGTTGGAAGG - Exonic
946934403 2:224704926-224704948 CAGCTGCACCCTCTTTTGGGAGG + Intergenic
1173907895 20:46642082-46642104 GAGCAGCAGGGTCTGTCGGGAGG - Intronic
1174423699 20:50417187-50417209 GAGCAGCAGCCTGTGCCGGGTGG + Intergenic
1179522814 21:41956130-41956152 CTGCCGCAGCCTCTTAAGGGTGG + Intergenic
1180950426 22:19718326-19718348 CCTCCGCAGCCGCTTTCGGGTGG + Intronic
1181592562 22:23894320-23894342 GAGCCGCAGCCTCGCGGGGGCGG + Exonic
1181756723 22:25029316-25029338 GTGCATCAGCCTGTTTCGGGAGG + Exonic
1184046832 22:41977103-41977125 GGGCCGCAGCCTCCTCCTGGCGG - Intronic
1184713764 22:46268597-46268619 GGGCCGCGGCCTCTCTCGGCAGG - Intronic
952339369 3:32432483-32432505 GAGCCACAGCCTCTATGGTGCGG + Intronic
961667054 3:128498993-128499015 GAGCCGTGGCCTCTCTAGGGAGG + Intergenic
967987255 3:195104620-195104642 CAGCAGCAGCCTCTCTCAGGTGG - Intronic
974555446 4:63440927-63440949 GAGGCACAGCTTCTTTCAGGTGG + Intergenic
988124092 5:27006488-27006510 GAGCCACAGCTTCTTTCAGATGG + Intronic
988792422 5:34620752-34620774 GAGACGCAGTCACTTCCGGGTGG - Intergenic
991198265 5:63960751-63960773 GTGCCCCCGCCTCTTTCGAGAGG - Exonic
998174951 5:139895982-139896004 GAGCCCCATCCTCTTTGGGGTGG + Intronic
998995931 5:147869369-147869391 GAGCCCCAGTCTCTTCCGGGAGG + Intergenic
1007075256 6:39062137-39062159 GCGCCGCAGCAGCTTCCGGGAGG + Intronic
1013463981 6:110400817-110400839 GAGCCGCACCTTCTTTCAGCTGG + Intronic
1019351601 7:556627-556649 GCGCCACAGCCCCTTCCGGGAGG - Intronic
1019365849 7:632417-632439 GAGCCGCAGGCTCCACCGGGGGG + Intronic
1029634686 7:101776143-101776165 GAGCCCCAGTCTCCTTCAGGGGG - Intergenic
1036484709 8:9169125-9169147 GACACTCAGCCTGTTTCGGGGGG + Intergenic
1036985130 8:13520796-13520818 GAGCCTCAGCCTCTATGGGCAGG - Intergenic
1037516938 8:19641382-19641404 CAGCAGCAGCCTCTTTTAGGAGG - Intronic
1049748047 8:144271245-144271267 CAGCTGCAGCCACTTTGGGGAGG - Intronic
1052192753 9:25677982-25678004 GAACCGCAGCCTCTTCCGTCAGG - Exonic
1055030509 9:71768516-71768538 CAGCCGCAGCCTCTGCCTGGAGG + Exonic
1061841765 9:133362626-133362648 GAGCCGCAGCCGCTGTGGGCAGG - Exonic
1062046928 9:134428629-134428651 GAGCCGCAGCCTCTTTCGGGGGG - Intronic
1062135268 9:134923558-134923580 GAGCCCCACCCTCTCTCAGGTGG - Intergenic
1192795557 X:74421917-74421939 CAGCCGAAGCCACCTTCGGGAGG - Exonic
1199592438 X:149479961-149479983 AAACCTCAGCCTCCTTCGGGAGG + Intergenic