ID: 1062046929

View in Genome Browser
Species Human (GRCh38)
Location 9:134428630-134428652
Sequence AGAGCCGCAGCCTCTTTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062046929_1062046936 14 Left 1062046929 9:134428630-134428652 CCCCCGAAAGAGGCTGCGGCTCT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046929_1062046937 17 Left 1062046929 9:134428630-134428652 CCCCCGAAAGAGGCTGCGGCTCT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1062046937 9:134428670-134428692 TTGGATAACCTGCTGTTTGGTGG No data
1062046929_1062046933 -2 Left 1062046929 9:134428630-134428652 CCCCCGAAAGAGGCTGCGGCTCT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046929_1062046939 30 Left 1062046929 9:134428630-134428652 CCCCCGAAAGAGGCTGCGGCTCT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1062046939 9:134428683-134428705 TGTTTGGTGGCATTCCACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062046929 Original CRISPR AGAGCCGCAGCCTCTTTCGG GGG (reversed) Intronic
900938897 1:5784970-5784992 AGAGCCCCAGCCACTTTCAGGGG + Intergenic
904676310 1:32201169-32201191 ACAGGCGCAGCCTTTGTCGGAGG + Intronic
922668487 1:227491973-227491995 TGAGCCACAGCCTCTTTCCCAGG - Intergenic
922874459 1:228929057-228929079 AGAGCCCCAGCCTCTAGCAGTGG + Intergenic
924117906 1:240765943-240765965 AAAGCCGCAGCCTGTTTCCCAGG + Intergenic
1066435800 10:35395964-35395986 AGACCCAAAGCCTCTCTCGGGGG - Intronic
1066551628 10:36564918-36564940 AGAGCGCCAGCCTCTCTCAGAGG - Intergenic
1067767341 10:49097002-49097024 AGAGCAGGAGCCTCTTAGGGAGG + Intronic
1070496778 10:77031675-77031697 AGAGATGCAGCCTCTGTTGGAGG + Intronic
1070627477 10:78061604-78061626 AGAGCCCCAGCTTCTCTCAGAGG - Intergenic
1075729599 10:124628378-124628400 AATACCGCAGCCTCCTTCGGAGG - Intronic
1077321145 11:1942614-1942636 AGGGCCGCAGGCTGTTTGGGGGG + Intergenic
1089817422 11:121188987-121189009 AGAGCCACTGCCTCTTTTAGAGG + Intronic
1093261983 12:16950188-16950210 GGAGCCGCAGCCACTTTGGCTGG + Intergenic
1096252130 12:50040160-50040182 AGGGCCTCAGCCTCTGGCGGTGG - Intergenic
1105776808 13:23669958-23669980 AGAGCAGCAACCTCTTTGTGGGG - Intronic
1113880467 13:113622700-113622722 AGAGCCGCAGCCTCTGTGGAAGG + Intronic
1119731710 14:76955485-76955507 AGAGCCGCAGGGGCTTTGGGAGG - Intergenic
1132060160 15:98685807-98685829 GGAGCCGCAGCCTCCTTGGGTGG + Intronic
1139650570 16:68360114-68360136 AGAGCCGCAGCCCCACCCGGGGG + Exonic
1140222843 16:73056807-73056829 ACTGCCCAAGCCTCTTTCGGAGG + Intronic
1141481133 16:84307739-84307761 GGCGCCCCAGCCTCCTTCGGAGG - Intronic
1144263315 17:13544544-13544566 ACAGCCCCAGCCTCTTTGTGTGG + Intronic
1151696609 17:75721293-75721315 GGAGCCGCAGCCCTTTCCGGGGG + Intergenic
1155009472 18:21761581-21761603 AGGGAAGCAGCCTCTTTAGGTGG - Intronic
1156864098 18:41869318-41869340 AGAGCTGAAGCCTCCTTCAGGGG + Intergenic
1168060276 19:53888071-53888093 AGAACAGCAGCCTCTGTCTGTGG + Intronic
927516404 2:23674370-23674392 AGGGCCCCAGCCTCATTCAGCGG + Intronic
929887781 2:45893895-45893917 AGAGCCCCAGCCTCTCCAGGAGG - Intronic
930590860 2:53324163-53324185 AGAGCTGCTGCCCCTTTGGGAGG - Intergenic
931232334 2:60385449-60385471 AGAGCAGCCTCCTCTTTCGTGGG + Intergenic
940446538 2:153784640-153784662 AGAGTTGCAGCCTCTTTTGCTGG - Intergenic
941164203 2:162067719-162067741 AGAGACACACCCTCTTTTGGAGG + Intronic
946079783 2:217107605-217107627 ATAGCAGCAGCCTCTTTCTGTGG - Intergenic
949011156 2:241679329-241679351 AGAGCCGCAGGCTCTGTGGGAGG - Intronic
1171184684 20:23116897-23116919 AGAGCAGCAGCCTGATTTGGAGG - Intergenic
1172600029 20:36177181-36177203 AGAGTCCCTGCCTCTTTGGGTGG + Intronic
1173993486 20:47320420-47320442 ACAGCCGCAGCATCTTTACGTGG - Intronic
1174413799 20:50353648-50353670 AGCTCCGCAGCCTCTTTCTCTGG - Intergenic
1175662340 20:60824478-60824500 AGAAACGAAGCCTCTTTCAGAGG - Intergenic
1177483720 21:21728021-21728043 AGTTCAGCAGCCTCTTTCAGCGG - Intergenic
1184722950 22:46326028-46326050 AGAGCCGCAGCCTGTCTGGTGGG - Intronic
954421040 3:50419135-50419157 AAAGCCTAAGCCTCTTTCCGTGG - Intronic
954971643 3:54656401-54656423 AGACCAGCAGCCTCTGTTGGAGG - Intronic
962166588 3:133055634-133055656 AGAGGAGCTGCCTCTTTCTGTGG - Intronic
967973147 3:195013960-195013982 AAAGCCTCAGCATCTTTAGGAGG + Intergenic
968222916 3:196951680-196951702 AGAGCAGCAGCCTCTCTCTCTGG - Intronic
977694519 4:99950745-99950767 CGACCCGCAGCCGCTTTCCGGGG + Intergenic
978788707 4:112638274-112638296 GGAGACGCAGCCTCTCTCAGTGG - Intronic
982274247 4:153623097-153623119 AGAGCCCCAGGCACTCTCGGTGG + Intronic
986318578 5:6609054-6609076 AGAGCTCCAGCCTTTTTCTGGGG - Intronic
991971580 5:72146840-72146862 ATAGCATCAGCCTCTTTCTGGGG + Intronic
997303860 5:132824792-132824814 ATCACCGCAGCCTCTTTCTGAGG + Exonic
1003172736 6:3733007-3733029 AGAGCCTCAGCCTCCTGCAGGGG - Intronic
1012998221 6:105994239-105994261 AGAGCCCGGGCCTCTTTAGGCGG - Intergenic
1015785950 6:136921961-136921983 AGAGCCGCTGGCTCTGTGGGGGG + Intergenic
1026534676 7:71229889-71229911 AGAGCGGCAGCCTGTGTCTGTGG + Intronic
1034879512 7:154752676-154752698 AGAGCTACAGCCTCCTGCGGTGG - Intronic
1035024025 7:155814991-155815013 AGAGCAGCAGCTTCTCTGGGGGG - Intergenic
1035744146 8:1949786-1949808 GGAGCCACAGCCTTTCTCGGTGG + Intronic
1038153064 8:24959440-24959462 AGAGTCGCAGTCTCTTTAGAAGG + Intergenic
1040007356 8:42631564-42631586 AGAGGCCCAGCCTCTTCCCGTGG - Intergenic
1044820673 8:96153873-96153895 AGAGCCGCAATCTCTGTCTGCGG + Intronic
1057298193 9:93861349-93861371 AGAGCCCCAGGCACTTTCCGCGG - Intergenic
1057568548 9:96185881-96185903 AGAACCACACCCTCTTTGGGAGG + Intergenic
1061513832 9:131077021-131077043 AGAGAAGCAGCCACTTTCCGAGG + Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062516475 9:136939481-136939503 GGTGGCGCAGCCTCTCTCGGTGG + Intronic
1186478467 X:9877656-9877678 AGAGCCACAGGCTATTTCGCTGG + Intronic
1187298545 X:18026311-18026333 AGAGCCGCACCCTCTCGGGGAGG + Intergenic
1188018392 X:25129686-25129708 AGAGCAGTAGCCTGTTTTGGTGG + Intergenic