ID: 1062046930

View in Genome Browser
Species Human (GRCh38)
Location 9:134428631-134428653
Sequence GAGAGCCGCAGCCTCTTTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062046930_1062046936 13 Left 1062046930 9:134428631-134428653 CCCCGAAAGAGGCTGCGGCTCTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046930_1062046939 29 Left 1062046930 9:134428631-134428653 CCCCGAAAGAGGCTGCGGCTCTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1062046939 9:134428683-134428705 TGTTTGGTGGCATTCCACGAAGG No data
1062046930_1062046933 -3 Left 1062046930 9:134428631-134428653 CCCCGAAAGAGGCTGCGGCTCTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046930_1062046940 30 Left 1062046930 9:134428631-134428653 CCCCGAAAGAGGCTGCGGCTCTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1062046940 9:134428684-134428706 GTTTGGTGGCATTCCACGAAGGG No data
1062046930_1062046937 16 Left 1062046930 9:134428631-134428653 CCCCGAAAGAGGCTGCGGCTCTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1062046937 9:134428670-134428692 TTGGATAACCTGCTGTTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062046930 Original CRISPR GAGAGCCGCAGCCTCTTTCG GGG (reversed) Intronic
900938896 1:5784969-5784991 GAGAGCCCCAGCCACTTTCAGGG + Intergenic
901173242 1:7279504-7279526 CAGAGCCGCAGCCACCTTCTCGG + Intronic
901211342 1:7527790-7527812 GAGAACCGCAGCCACTTGTGGGG - Intronic
902620631 1:17648704-17648726 GGGAGCCGCAGCCACCTTCGAGG - Intronic
910124365 1:83824093-83824115 GAGAGCCACTGGATCTTTCGAGG + Intergenic
915353236 1:155239680-155239702 GAGAGCAGCAGCATCTGTCATGG + Exonic
920099810 1:203509936-203509958 GAGAGCCGCAGCACCTCTCTTGG + Intergenic
920817118 1:209345076-209345098 GAGATCTGAAGCCTCTTCCGAGG - Intergenic
921235905 1:213129715-213129737 GAAAGTCGTAGCCTCTTTCCTGG + Exonic
1076812824 10:132898172-132898194 GAGAGTCTCAGCCTCTTTCCAGG + Intronic
1077056354 11:595712-595734 GTGAGCCGCAGCCTCCTCCAAGG + Intronic
1077321144 11:1942613-1942635 GAGGGCCGCAGGCTGTTTGGGGG + Intergenic
1079276022 11:19038425-19038447 GAGACCTCCAGCCTCTTTCTAGG - Intergenic
1084385664 11:68841571-68841593 GGGAGCCCCGGCCTCTTTCTGGG + Intronic
1085296682 11:75435353-75435375 GTCAGCCGCAGCCTCTCTTGAGG - Exonic
1089049718 11:115535735-115535757 GAGAGCAGCTGCTTCTTGCGAGG - Intergenic
1089617746 11:119704567-119704589 GAAATCCACAGCCTCTTTCTGGG - Intronic
1090349848 11:126101042-126101064 GAGGCCCGCGGCCTCTCTCGTGG + Intergenic
1097188130 12:57206511-57206533 GAGATCCGCAGCCTGTTCCCCGG + Exonic
1104104966 12:125650421-125650443 CAGAGCCTCAGCCTCTGTCTGGG + Intronic
1104604781 12:130179910-130179932 GAGAGCTGCAGCCTCGATGGAGG - Intergenic
1105776809 13:23669959-23669981 GAGAGCAGCAACCTCTTTGTGGG - Intronic
1108549998 13:51534551-51534573 GACAGCCGCAGCCACTTCCTGGG + Intergenic
1117699183 14:58396184-58396206 GAGTGCCTCAGCCTCTGCCGAGG + Intronic
1119856415 14:77904521-77904543 GCCAGGCGCAGCCTGTTTCGTGG + Intronic
1122345938 14:101060279-101060301 GGGAACTGCCGCCTCTTTCGAGG - Intergenic
1124458458 15:29866831-29866853 GAGATCTGCAGGCTCTTTCCAGG + Intronic
1135100581 16:19601702-19601724 GATAGCCGCAGCGTCTTACCAGG + Exonic
1135547259 16:23374687-23374709 GAGAGCCACAGACTCGTTAGGGG + Intronic
1137426720 16:48385939-48385961 GAGAGTCCCAGCCTCTCCCGAGG + Intronic
1139432403 16:66918186-66918208 GAGAGCCTCAGCTCCTTTGGAGG - Intronic
1149641455 17:58205615-58205637 GTGAGTCTCAGCCTCTTTCCAGG - Exonic
1151696608 17:75721292-75721314 GGGAGCCGCAGCCCTTTCCGGGG + Intergenic
1162998358 19:14350587-14350609 AAGACCCACAGCCTCTCTCGTGG - Intergenic
1163262237 19:16198206-16198228 GAGAGCCCCATCCTGTTTCTGGG + Intronic
931232333 2:60385448-60385470 AAGAGCAGCCTCCTCTTTCGTGG + Intergenic
931794834 2:65699441-65699463 GAGAGCAGCAGACTCAATCGAGG + Intergenic
935061892 2:99615677-99615699 GGGAGGCGCTGCCTCTTTGGAGG + Intronic
938449800 2:131407504-131407526 AAGAGCCACAGCCTATTCCGAGG - Intergenic
940955793 2:159725982-159726004 GAGACCCACAGACTCTTTTGTGG - Intronic
941436640 2:165481385-165481407 GGGAGCACCAGCCTCTTTCCTGG + Intronic
944763573 2:202841628-202841650 GTGGGCAGCAGCATCTTTCGGGG - Intronic
945044975 2:205773965-205773987 GTGAGCTGCAGCCTCATTAGGGG + Intronic
1181015165 22:20064387-20064409 GAGAGCAGCAGCCTCAGTCTTGG - Intronic
1181235531 22:21445871-21445893 GAGTGCCGGAGGCTCTTCCGAGG - Exonic
1184722951 22:46326029-46326051 CAGAGCCGCAGCCTGTCTGGTGG - Intronic
961710925 3:128827619-128827641 GACAGCTGCAGCCCCTTTCTAGG - Intergenic
962065213 3:131972522-131972544 GAGAGCAGCAGCTTCCTTGGGGG - Intronic
962334141 3:134510861-134510883 GAGAGCAGCAGACTCTTCCAAGG + Intronic
964816138 3:160719695-160719717 CACAGCCGCGGCCTCTTTTGGGG - Intergenic
969616262 4:8254516-8254538 GAGAGCCGCGTCCTGATTCGTGG + Intergenic
976303332 4:83535986-83536008 GAGTGCCGCAGCCTCCTGGGCGG - Exonic
977694518 4:99950744-99950766 GCGACCCGCAGCCGCTTTCCGGG + Intergenic
990386751 5:55272029-55272051 AAGAGCCCCAACCTCTTTCCAGG + Intronic
996485105 5:124024392-124024414 GAGAGCAGAAGCCTGTTTCCAGG - Intergenic
1002533454 5:179863212-179863234 GGGAGCCACAGCCTCTTCCTGGG + Exonic
1008092108 6:47304393-47304415 GAGAGGTGAAGCCTCTTTGGAGG - Intronic
1015785949 6:136921960-136921982 GAGAGCCGCTGGCTCTGTGGGGG + Intergenic
1018674196 6:166205128-166205150 GAGAGTCACAGCCACTTTCTGGG - Intergenic
1019297809 7:288336-288358 GGGAGCTGCAGCCTGTTTTGGGG - Intergenic
1037901674 8:22692530-22692552 GAGAACCGAAGCCTCTACCGTGG + Intronic
1044754430 8:95446807-95446829 GAGAGGAGCAGCCTCTATTGTGG - Intergenic
1048866804 8:138767428-138767450 GAGAGGAGCAGCCTCTCTCCAGG - Intronic
1049661445 8:143821367-143821389 AAGCGCCGCAGCCCCTTTCTTGG - Intronic
1053725300 9:40992660-40992682 GAGAGGGGCAGCCTCCTGCGCGG + Intergenic
1060033592 9:120236101-120236123 GAGAGCTTCTGCCTCTTTCTTGG + Intergenic
1062046930 9:134428631-134428653 GAGAGCCGCAGCCTCTTTCGGGG - Intronic
1062411055 9:136424655-136424677 GAGAGGTGCAGCCTCTTTGCAGG + Intergenic
1062733586 9:138122173-138122195 GAGAGCCGCATCCTCTAACAGGG - Exonic
1191719186 X:64215308-64215330 GACAGCTGCAGCCCCTTTCTAGG - Intergenic