ID: 1062046931

View in Genome Browser
Species Human (GRCh38)
Location 9:134428632-134428654
Sequence TGAGAGCCGCAGCCTCTTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062046931_1062046939 28 Left 1062046931 9:134428632-134428654 CCCGAAAGAGGCTGCGGCTCTCA 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1062046939 9:134428683-134428705 TGTTTGGTGGCATTCCACGAAGG No data
1062046931_1062046937 15 Left 1062046931 9:134428632-134428654 CCCGAAAGAGGCTGCGGCTCTCA 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1062046937 9:134428670-134428692 TTGGATAACCTGCTGTTTGGTGG No data
1062046931_1062046936 12 Left 1062046931 9:134428632-134428654 CCCGAAAGAGGCTGCGGCTCTCA 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046931_1062046933 -4 Left 1062046931 9:134428632-134428654 CCCGAAAGAGGCTGCGGCTCTCA 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046931_1062046940 29 Left 1062046931 9:134428632-134428654 CCCGAAAGAGGCTGCGGCTCTCA 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1062046940 9:134428684-134428706 GTTTGGTGGCATTCCACGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062046931 Original CRISPR TGAGAGCCGCAGCCTCTTTC GGG (reversed) Intronic
900938895 1:5784968-5784990 GGAGAGCCCCAGCCACTTTCAGG + Intergenic
901673270 1:10868065-10868087 GGAGAGCAGAGGCCTCTTTCAGG + Intergenic
902644073 1:17786012-17786034 TGAGGGCTCCAGCCTATTTCTGG + Intronic
903328101 1:22582765-22582787 TGAGAGGCCCTTCCTCTTTCTGG - Intronic
903767658 1:25745012-25745034 TGGGAGGCGCCACCTCTTTCAGG + Intronic
905208158 1:36354810-36354832 GGAGAGCCTGAGCCTCTTCCCGG - Intronic
912551038 1:110485483-110485505 TCAGAGCAGCATCTTCTTTCAGG + Intergenic
912800816 1:112718910-112718932 TGGGCGCCGCCGCCTCCTTCGGG - Intergenic
914696946 1:150092361-150092383 TGATAGCCACAGCATCTTTGGGG - Exonic
916247600 1:162704682-162704704 TGAGGGTGGCACCCTCTTTCAGG - Intronic
920963570 1:210684247-210684269 TGTGAGCCCCAGCCTCTTGGTGG - Intronic
921612422 1:217228141-217228163 TGGAAGCCGCAGTCTCTTGCTGG - Intergenic
923078689 1:230633320-230633342 TGAGGGCCCCAGCCTCTTTTTGG - Intergenic
923863007 1:237911150-237911172 TAAGAGCCTCAGCCTCTGTGTGG - Intergenic
1063627947 10:7708252-7708274 TGAGAGCTGCAAGCTCCTTCAGG - Intronic
1064186701 10:13168116-13168138 TGTGAGCCAGAGCCTCTTCCCGG + Intronic
1067161307 10:43826904-43826926 TGAGAGCAGCAGCCTCTCCGCGG + Intergenic
1071505915 10:86231392-86231414 TTAGAGCCAGAGCCTCTGTCCGG - Intronic
1073080767 10:100859249-100859271 TCAGAGCCGCTGCACCTTTCAGG - Intergenic
1073099230 10:100998294-100998316 CGAGAGCCTCCTCCTCTTTCTGG - Intronic
1074040498 10:109783723-109783745 TGAGGGCCCCAGTTTCTTTCTGG - Intergenic
1074419735 10:113298436-113298458 TTAAAGCCGCAGTCTCTTCCAGG + Intergenic
1074963702 10:118470360-118470382 TGATAGCCACAGTCACTTTCTGG - Intergenic
1078483897 11:11704437-11704459 TGAGAATTGCAGCCTCTTTGGGG + Intergenic
1083585181 11:63851999-63852021 AGAGACCCTCAGACTCTTTCAGG + Intronic
1083973398 11:66097420-66097442 TGAGGGCCACAGTCTCTTGCTGG - Intronic
1084385663 11:68841570-68841592 GGGGAGCCCCGGCCTCTTTCTGG + Intronic
1086216141 11:84383661-84383683 TGAGAGCCTCAGCTTCTTATTGG - Intronic
1089617747 11:119704568-119704590 TGAAATCCACAGCCTCTTTCTGG - Intronic
1089883170 11:121794603-121794625 TGGGATGTGCAGCCTCTTTCTGG + Intergenic
1091057234 11:132430386-132430408 TGAGAGCCGCTGCCTGGTGCAGG + Intronic
1095899269 12:47311146-47311168 TGAGGGCCTCAGTCTCTTGCTGG + Intergenic
1096792582 12:54054214-54054236 TGCGAGCCGGCGCCTCTCTCAGG + Exonic
1104104965 12:125650420-125650442 CCAGAGCCTCAGCCTCTGTCTGG + Intronic
1105776810 13:23669960-23669982 TGAGAGCAGCAACCTCTTTGTGG - Intronic
1108549997 13:51534550-51534572 AGACAGCCGCAGCCACTTCCTGG + Intergenic
1111628217 13:90815715-90815737 TGGGAGCCTCAGTCTCTTTTTGG - Intergenic
1111835921 13:93388314-93388336 TGAGACCTGAAGCATCTTTCTGG + Intronic
1113777526 13:112956605-112956627 TGAAAGCCGCAGCCACTGGCAGG - Intronic
1118049569 14:62012314-62012336 TGAGGGCCCCAGCTTCTTGCTGG + Intronic
1119703611 14:76770920-76770942 TCCCAGCCACAGCCTCTTTCTGG + Intronic
1123981657 15:25610238-25610260 TGAGAGCCACAGCCTCTGTGTGG - Intergenic
1124625765 15:31306749-31306771 TGAGAGCTGCAGCCTCGCTCAGG + Intergenic
1125573963 15:40742389-40742411 TGAGGGACGCTGCCTCTTTGGGG + Intronic
1127313923 15:57776983-57777005 AGAGAGGGGCAGCCTCTCTCAGG + Intronic
1129695581 15:77739062-77739084 TGAGAGCCGCAGACTCCCTGGGG - Intronic
1130151740 15:81316442-81316464 AGAGAGCCACAGTCTCATTCTGG - Intronic
1131986940 15:98052125-98052147 TGAGAGCAGCAGCTTCTGCCAGG + Intergenic
1132813772 16:1816359-1816381 TGAGAGTCGCTGCCTCTGACAGG - Intronic
1136712260 16:32248713-32248735 TCCAAGCCGCAGCCTTTTTCAGG - Intergenic
1136755655 16:32680691-32680713 TCCAAGCCGCAGCCTTTTTCAGG + Intergenic
1136812458 16:33189681-33189703 TCCAAGCCGCAGCCTTTTTCAGG - Intergenic
1136818934 16:33299761-33299783 TCCAAGCCGCAGCCTTTTTCAGG - Intronic
1136825497 16:33356294-33356316 TCCAAGCCGCAGCCTTTTTCAGG - Intergenic
1136830563 16:33455065-33455087 TCCAAGCCGCAGCCTTTTTCAGG - Intergenic
1137581653 16:49637289-49637311 TGAGAGCCGCTGCCGCTTCGGGG + Exonic
1138457984 16:57132246-57132268 TGAGACCCTCAGCCACTCTCTGG - Intronic
1139706602 16:68745198-68745220 TGTGAGCCACAGCATCTATCTGG - Intronic
1142012112 16:87720820-87720842 CCACAGCCGCAGCCTCTTTGGGG + Intronic
1202991035 16_KI270728v1_random:12651-12673 TCCAAGCCGCAGCCTTTTTCAGG - Intergenic
1203057797 16_KI270728v1_random:941047-941069 TCCAAGCCGCAGCCTTTTTCAGG + Intergenic
1142609416 17:1100439-1100461 TGAGAGGCACAGGCCCTTTCTGG + Intronic
1146218762 17:31000240-31000262 TGAGGGCCTCAGTTTCTTTCTGG + Intergenic
1147156337 17:38546233-38546255 TGAGAGCAGCAGTCACTTCCCGG - Intronic
1147306958 17:39570635-39570657 TGAGAGAGGCAGATTCTTTCAGG - Intergenic
1148054435 17:44785735-44785757 TGGGAGCCAGAGCCCCTTTCAGG - Intergenic
1149505290 17:57189115-57189137 TGGGAGCCCCAGCTTCTTACTGG - Intergenic
1150599475 17:66638192-66638214 TGAGAGCCAGATCCTCATTCTGG + Intronic
1151864702 17:76793313-76793335 TCAGGGCCGCATTCTCTTTCAGG + Intergenic
1151996190 17:77610744-77610766 TGAGGGCTGCATCCTCTCTCTGG - Intergenic
1156253923 18:35377254-35377276 TGAGACCCGAGGCCTCTTTAGGG - Intronic
1157988364 18:52465573-52465595 AAAGGGCCGCAGCCTCTTTGGGG - Intronic
1159155862 18:64580670-64580692 TGAGAGCCTAAGTCTCTTTGTGG - Intergenic
1159558282 18:69967594-69967616 TCAGAGCCGCAGCATCGTCCTGG - Intergenic
1160783837 19:890800-890822 TGAGAGCCTCAGCCTCCTGGGGG - Intronic
1162226919 19:9230430-9230452 TGGAAGCTGAAGCCTCTTTCCGG + Intergenic
1162600082 19:11662296-11662318 TGAGAGCCGCAGCCTACTCTTGG + Intergenic
1163262236 19:16198205-16198227 TGAGAGCCCCATCCTGTTTCTGG + Intronic
1165830621 19:38728609-38728631 GGAGAGCTGCCCCCTCTTTCTGG - Intronic
1166316744 19:41993753-41993775 TGAGAGCTGCTGGCTCTGTCAGG - Intronic
1166380204 19:42351602-42351624 TCAGAGCCCCAGCCCCTTGCCGG - Intronic
1167497558 19:49828467-49828489 TGAGAGCTGCAGCCTCATCGCGG + Exonic
1168298073 19:55387518-55387540 TGAGAGGCCCAGCCTCACTCAGG - Intronic
928562070 2:32499863-32499885 TTAGTGCAGCTGCCTCTTTCAGG + Exonic
930735355 2:54773146-54773168 GGAGAGCCACAGCCTCTAGCTGG - Intronic
931584570 2:63811468-63811490 TGAGAGCCCCAGCTTCTTTCTGG - Intronic
938873670 2:135510052-135510074 TGAGAGTCACAACCACTTTCTGG - Intronic
947085750 2:226450372-226450394 TAAGAGCCACAGTGTCTTTCTGG - Intergenic
947612820 2:231534111-231534133 TGAGAGACACAGGCTTTTTCTGG - Intergenic
1169170568 20:3461367-3461389 TCAGAGCAGCAGCATCTTGCAGG - Intergenic
1172882534 20:38211316-38211338 TGTGCCCCACAGCCTCTTTCTGG + Exonic
1174163390 20:48567534-48567556 TGGGAGCTGCAGCCTGTGTCTGG - Intergenic
1178385199 21:32143438-32143460 TGACGGCCACAGCCTCTTGCTGG + Intergenic
1179380661 21:40896123-40896145 TGAGTACAACAGCCTCTTTCAGG - Intergenic
1182498580 22:30728776-30728798 TGTGAGCCACTGCCTCTTCCAGG + Intronic
956308617 3:67854149-67854171 TGACAGCAGCTGCCTCATTCTGG + Intergenic
959396334 3:105842793-105842815 TCAGAGACCCAGGCTCTTTCTGG - Intronic
962065214 3:131972523-131972545 TGAGAGCAGCAGCTTCCTTGGGG - Intronic
964847128 3:161056216-161056238 TGAGAGCCTCAGCTGCTTTTAGG - Intronic
968654972 4:1774517-1774539 TGAGAACCCCATCCTCCTTCTGG - Intergenic
969880235 4:10167278-10167300 TGAGAGAAGCAGGCTCTTCCAGG + Intergenic
972409914 4:38783268-38783290 TGAGAAGCCCAGCCTCTTGCGGG - Intergenic
973085322 4:46052177-46052199 TGAGAGACTCAGTCTCCTTCTGG - Intronic
973555235 4:52075597-52075619 TGAGAGCCTCATCCTTTTCCAGG - Intronic
977694517 4:99950743-99950765 TGCGACCCGCAGCCGCTTTCCGG + Intergenic
982534632 4:156594847-156594869 TGAGGGCCTCAGTCTCTTGCTGG - Intergenic
984767394 4:183410085-183410107 TCAGAGCCCATGCCTCTTTCTGG + Intergenic
987905179 5:24067554-24067576 TGAGAGTCTCAGCTTCTTACCGG + Intronic
988036885 5:25838623-25838645 TGAGAACCTCAGTTTCTTTCTGG - Intergenic
991617936 5:68516685-68516707 TGGGAACCGAAGCCTCCTTCAGG - Intergenic
996444792 5:123534620-123534642 TGAGAGCCCCAGCTTTTTGCTGG - Intronic
997871268 5:137507053-137507075 GGTGAGCTGGAGCCTCTTTCGGG - Intronic
999991050 5:157050201-157050223 AGAGAGCCACATCCTCTTACAGG - Intronic
1002533453 5:179863211-179863233 TGGGAGCCACAGCCTCTTCCTGG + Exonic
1003075087 6:2976595-2976617 GGAGAGCCTCACCCTCTCTCCGG + Intergenic
1004161114 6:13213746-13213768 TGAGGGCTGCAGCCTCTGGCTGG - Intronic
1004914653 6:20320487-20320509 TGAGCGCTGCCCCCTCTTTCAGG + Intergenic
1006587696 6:35128263-35128285 TGAGGGCCCCAGCTTCTTACTGG + Intronic
1007391562 6:41552335-41552357 TTACAGCCGCAGCCTCTCGCTGG - Intronic
1009626872 6:66146053-66146075 TGAGACCCGCAGCCGCTGCCAGG - Intergenic
1014384601 6:120785646-120785668 TGAGAGCCCCACCCTCTAGCAGG + Intergenic
1014967838 6:127778514-127778536 TTATAGACGCCGCCTCTTTCAGG + Intronic
1018055711 6:160050538-160050560 GGACAGCGGCAGCCTCCTTCTGG + Exonic
1018674197 6:166205129-166205151 GGAGAGTCACAGCCACTTTCTGG - Intergenic
1018758991 6:166873882-166873904 TCAGAACTGCAGCCTCTTTCAGG + Intronic
1019176303 6:170160999-170161021 TGAGAAGAGCTGCCTCTTTCGGG - Intergenic
1019314938 7:379992-380014 TGAGAGCCGCAGGGACTTCCGGG + Intergenic
1019934371 7:4244815-4244837 TGAGGGCCCCAGCCTCTTCTTGG + Intronic
1019984627 7:4646672-4646694 TGATGGCCTCAGCTTCTTTCTGG - Intergenic
1023318243 7:38964164-38964186 TGAGGGCCTCAGCTTCTTGCTGG + Intergenic
1023327789 7:39078759-39078781 TGAGAGAGGCAGCTACTTTCAGG + Intronic
1023866904 7:44242671-44242693 TGAGCACCGCAGCCACTTGCAGG + Intronic
1024260237 7:47568848-47568870 AGTGGGCCGCAGCCTCTTTGAGG + Intronic
1030724108 7:112904924-112904946 TGAGAGGGGCAGTCTCTCTCTGG - Intronic
1032013218 7:128360133-128360155 TGAGATCAGAAGCCTCTCTCTGG - Intronic
1032465232 7:132140305-132140327 TGGGAGCCGCATCTCCTTTCTGG + Intronic
1032639894 7:133754274-133754296 TGAGAGCAGAAGCAGCTTTCTGG + Intronic
1038375786 8:27038860-27038882 TGAGAAACGCAGCTTTTTTCTGG - Intergenic
1039096248 8:33889481-33889503 TGACAGCAGCAACCTCTTTAAGG + Intergenic
1049003133 8:139838635-139838657 TCACAGCAGCAGCCTCTTCCTGG - Intronic
1049748048 8:144271248-144271270 TGACAGCTGCAGCCACTTTGGGG - Intronic
1055030508 9:71768513-71768535 TGGCAGCCGCAGCCTCTGCCTGG + Exonic
1058187315 9:101870026-101870048 TGAGAGCTTCAGCTTCTTGCTGG + Intergenic
1061398974 9:130358125-130358147 GGTGAGCCTCAGCCTCTTCCGGG + Intronic
1062046931 9:134428632-134428654 TGAGAGCCGCAGCCTCTTTCGGG - Intronic
1062733587 9:138122174-138122196 AGAGAGCCGCATCCTCTAACAGG - Exonic
1192231062 X:69265364-69265386 TGAGACCCGCAGTCTCTGTGTGG - Intergenic
1199826965 X:151509938-151509960 GGAGAGCCACAGCCTTGTTCTGG - Intergenic