ID: 1062046932

View in Genome Browser
Species Human (GRCh38)
Location 9:134428633-134428655
Sequence GTGAGAGCCGCAGCCTCTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062046932_1062046933 -5 Left 1062046932 9:134428633-134428655 CCGAAAGAGGCTGCGGCTCTCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046932_1062046937 14 Left 1062046932 9:134428633-134428655 CCGAAAGAGGCTGCGGCTCTCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1062046937 9:134428670-134428692 TTGGATAACCTGCTGTTTGGTGG No data
1062046932_1062046939 27 Left 1062046932 9:134428633-134428655 CCGAAAGAGGCTGCGGCTCTCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1062046939 9:134428683-134428705 TGTTTGGTGGCATTCCACGAAGG No data
1062046932_1062046940 28 Left 1062046932 9:134428633-134428655 CCGAAAGAGGCTGCGGCTCTCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1062046940 9:134428684-134428706 GTTTGGTGGCATTCCACGAAGGG No data
1062046932_1062046936 11 Left 1062046932 9:134428633-134428655 CCGAAAGAGGCTGCGGCTCTCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062046932 Original CRISPR GTGAGAGCCGCAGCCTCTTT CGG (reversed) Intronic
900389412 1:2427525-2427547 GTGGGAGCCTCAGCCTCTCCAGG - Intronic
900513219 1:3069912-3069934 GGGACAGCCGCAGCCACTTGGGG + Intronic
900680585 1:3914236-3914258 GTGAGGGCCGGAGCCTCACTGGG + Intergenic
912800817 1:112718911-112718933 GTGGGCGCCGCCGCCTCCTTCGG - Intergenic
913381096 1:118210908-118210930 GTGAGAGCAGCGTTCTCTTTAGG + Intergenic
914696947 1:150092362-150092384 GTGATAGCCACAGCATCTTTGGG - Exonic
921322491 1:213955464-213955486 GTGAGACCCTCGGCCTTTTTTGG - Intergenic
1068720389 10:60238772-60238794 GTGAGAGGTGGAGCCTGTTTTGG - Intronic
1070526383 10:77299355-77299377 GTCAAAGCAGCAGCCTCCTTAGG - Intronic
1072923187 10:99593964-99593986 GTCAGAGCCACAGCCTCTCTGGG - Intergenic
1076771359 10:132667209-132667231 GTCTAAGCCGCAGCCCCTTTTGG + Intronic
1077199782 11:1300584-1300606 GAGAGAGCCGCTGCTTCCTTGGG + Intronic
1077321142 11:1942611-1942633 GGGAGGGCCGCAGGCTGTTTGGG + Intergenic
1077695919 11:4393156-4393178 GTGAGAGGGGCAGGCTGTTTAGG - Intronic
1078483896 11:11704436-11704458 ATGAGAATTGCAGCCTCTTTGGG + Intergenic
1081665691 11:44915884-44915906 GTGAGAGCAGAAGCCTGTGTCGG + Intronic
1082967228 11:58979176-58979198 GTGAGATCAGCAGCATCTCTAGG - Intronic
1084666523 11:70579383-70579405 GTGCCAGCTGCAGCCTCTTCTGG - Intronic
1085259410 11:75195739-75195761 CTGAAAGGCGCAGCCTCTCTGGG + Intronic
1089793640 11:120962688-120962710 GGGAGAGGAACAGCCTCTTTGGG + Intronic
1093169060 12:15838467-15838489 GTGACAGCAGCAGCCTCAGTAGG - Intronic
1093219360 12:16400391-16400413 GTGAGCCTTGCAGCCTCTTTTGG + Intronic
1094396214 12:30008697-30008719 TTGTGAACTGCAGCCTCTTTTGG + Intergenic
1097507894 12:60499286-60499308 GTCAGAGCCTCAGCTGCTTTAGG + Intergenic
1125080967 15:35672714-35672736 GTAAGATCCTCTGCCTCTTTAGG + Intergenic
1125573962 15:40742388-40742410 ATGAGGGACGCTGCCTCTTTGGG + Intronic
1129695582 15:77739063-77739085 GTGAGAGCCGCAGACTCCCTGGG - Intronic
1132060159 15:98685804-98685826 CTTGGAGCCGCAGCCTCCTTGGG + Intronic
1132185428 15:99798744-99798766 GTGATTGCCGGAGCCCCTTTTGG + Intergenic
1132431562 15:101765784-101765806 GTGATCGCCGGAGCCCCTTTTGG - Intergenic
1133487466 16:6234000-6234022 GTGAGAGCTGCATCCTCTGGAGG + Intronic
1137327891 16:47460570-47460592 GTGAGGGCCGCAGACTTCTTAGG + Intronic
1137581652 16:49637288-49637310 CTGAGAGCCGCTGCCGCTTCGGG + Exonic
1139080330 16:63510219-63510241 GTGATAGACACACCCTCTTTAGG + Intergenic
1140286998 16:73613222-73613244 GCCAGAGCTGCATCCTCTTTTGG + Intergenic
1142012110 16:87720819-87720841 GCCACAGCCGCAGCCTCTTTGGG + Intronic
1143375991 17:6468082-6468104 GTGTGAGCCCCAGCCTGTTTGGG + Intronic
1147448383 17:40488794-40488816 GTGAGAGCCTCATCTTCTCTGGG - Exonic
1148673768 17:49432990-49433012 GTAACAACTGCAGCCTCTTTAGG + Intronic
1148866491 17:50631438-50631460 GTGGGAGCTGCAGCCTGGTTTGG + Intergenic
1149451145 17:56751078-56751100 GTGGGAGCAGCAGCATTTTTTGG - Intergenic
1155009473 18:21761584-21761606 GGGAGGGAAGCAGCCTCTTTAGG - Intronic
1155065440 18:22265240-22265262 GAGTGAGCTGCAGGCTCTTTTGG - Intergenic
1156253924 18:35377255-35377277 GTGAGACCCGAGGCCTCTTTAGG - Intronic
1157988365 18:52465574-52465596 CAAAGGGCCGCAGCCTCTTTGGG - Intronic
1160783838 19:890801-890823 GTGAGAGCCTCAGCCTCCTGGGG - Intronic
1161381668 19:3968742-3968764 GAGAGTGCTGCAGGCTCTTTTGG - Intronic
1161912261 19:7203429-7203451 GAGAGAACCGCAGCCTCCATGGG + Intronic
1163786811 19:19279043-19279065 GTGAGAGGCTCAGTCTCTCTGGG - Intronic
926625214 2:15085240-15085262 GTGAGAGCGGCACCCACTTCAGG + Intergenic
926959023 2:18333012-18333034 GTGATGGCAGCAGCCTCTTGAGG + Intronic
928121658 2:28588086-28588108 GAGAGAGCCGTAGCTTCTGTGGG - Intronic
937748572 2:125446030-125446052 GTGAGAGTTGCAGGGTCTTTTGG - Intergenic
937841251 2:126526748-126526770 GTGTGAGCAGCAGCCTCCTGAGG + Intergenic
941164202 2:162067716-162067738 TTGAGAGACACACCCTCTTTTGG + Intronic
942042881 2:172082618-172082640 GTGTTAGCCGCAGCCACTCTTGG - Intergenic
945044973 2:205773963-205773985 GGGTGAGCTGCAGCCTCATTAGG + Intronic
949011157 2:241679332-241679354 GACAGAGCCGCAGGCTCTGTGGG - Intronic
1171144633 20:22770800-22770822 GTGAGTGCAGCAGCTTATTTTGG - Intergenic
1172701740 20:36857574-36857596 GTCCCAGCCGCAGCCTCCTTGGG - Intronic
1177953425 21:27567389-27567411 TTGAGAGCCCCATTCTCTTTGGG - Intergenic
1178051694 21:28754523-28754545 GCTAGAGCAGCAGGCTCTTTAGG + Intergenic
1179912119 21:44455936-44455958 GTGCGAGCCGCGGCTCCTTTAGG + Intronic
1181006313 22:20015349-20015371 GTGTGAGCCGCAGCGTGTCTGGG - Intronic
954649663 3:52153511-52153533 GTGAGAGCAGAAGGCTCTGTTGG - Intronic
956209710 3:66790155-66790177 GGGAGAACCACAGCCCCTTTCGG - Intergenic
961055915 3:123788845-123788867 GTGTGAGCCGAAACCTCATTTGG + Intronic
962065215 3:131972524-131972546 ATGAGAGCAGCAGCTTCCTTGGG - Intronic
964180928 3:153884738-153884760 GTGATACCCTGAGCCTCTTTGGG + Intergenic
969067249 4:4496274-4496296 GTGAGAGCCTCAGCGATTTTTGG - Intronic
985639359 5:1056406-1056428 GTGGGAGCCGCAGCAGCTCTGGG + Intronic
995123156 5:108556500-108556522 TTGAGAGACTCAGCCTCTGTGGG + Intergenic
998508597 5:142692430-142692452 GTGAGAGTTGCACCATCTTTTGG - Intronic
1000618734 5:163459696-163459718 GTCAGAGCCCCCGCCTCTTCAGG - Intronic
1002046338 5:176543500-176543522 GTGCGGGGCGGAGCCTCTTTCGG + Intronic
1002649190 5:180679364-180679386 TTGAGGGCCGCAGGCTCTCTGGG - Intergenic
1011481241 6:87796096-87796118 TGGAGAGCCGAAGCCTCTTCGGG + Intergenic
1012998222 6:105994242-105994264 GGGAGAGCCCGGGCCTCTTTAGG - Intergenic
1013056804 6:106590811-106590833 GTCAGGGCCTAAGCCTCTTTGGG - Intronic
1015785947 6:136921958-136921980 GCGAGAGCCGCTGGCTCTGTGGG + Intergenic
1018634223 6:165846755-165846777 GTGAGAGCCGCAAGCCCTGTGGG + Intronic
1019314937 7:379991-380013 GTGAGAGCCGCAGGGACTTCCGG + Intergenic
1019883114 7:3880776-3880798 GTGCGAGCCGCAGCCTCTGGAGG - Intronic
1024813987 7:53245943-53245965 GAGAGAGCCTCAGCCTCCTCAGG - Intergenic
1036484054 8:9163834-9163856 CTGAGAGCTGCAGCCTCGTGTGG - Intronic
1036985131 8:13520800-13520822 GGAAGAGCCTCAGCCTCTATGGG - Intergenic
1037831913 8:22194779-22194801 GTGAGAGCAGCACCCTCATCGGG + Exonic
1040450339 8:47539808-47539830 GTGAGACCTGCAGCCTTGTTAGG + Intronic
1043543256 8:81286846-81286868 GTGTGGGCTGCAGCCTCCTTGGG - Intergenic
1049748049 8:144271249-144271271 CTGACAGCTGCAGCCACTTTGGG - Intronic
1051400703 9:16678999-16679021 GTGAGAGCCTCTGACACTTTGGG - Intronic
1055266427 9:74499343-74499365 GTGAGACCCGCTGCCTCCTGGGG - Intronic
1055470508 9:76605793-76605815 GTGAGAGCCACCACATCTTTAGG - Intergenic
1057217118 9:93235218-93235240 GTGAGAGCGACAGCCTCCATGGG - Intronic
1061398973 9:130358124-130358146 GGGTGAGCCTCAGCCTCTTCCGG + Intronic
1061824902 9:133252089-133252111 GGGAGAGCTGCTGCCTCTGTGGG - Intronic
1062046932 9:134428633-134428655 GTGAGAGCCGCAGCCTCTTTCGG - Intronic
1188018391 X:25129683-25129705 GAGAGAGCAGTAGCCTGTTTTGG + Intergenic
1190140306 X:47836900-47836922 GCGAGAACCGCAGCCGCTTCCGG - Exonic
1195872645 X:109501950-109501972 GTGACAGCCTGAGCCGCTTTTGG + Intergenic
1195968864 X:110453282-110453304 GTGCGAGCCCCAGCCTCTGGAGG + Exonic