ID: 1062046933

View in Genome Browser
Species Human (GRCh38)
Location 9:134428651-134428673
Sequence CTCACGCACCTGCCTTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062046928_1062046933 -1 Left 1062046928 9:134428629-134428651 CCCCCCGAAAGAGGCTGCGGCTC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046922_1062046933 11 Left 1062046922 9:134428617-134428639 CCCCCTGGGAATCCCCCCGAAAG 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046925_1062046933 8 Left 1062046925 9:134428620-134428642 CCTGGGAATCCCCCCGAAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046931_1062046933 -4 Left 1062046931 9:134428632-134428654 CCCGAAAGAGGCTGCGGCTCTCA 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046919_1062046933 21 Left 1062046919 9:134428607-134428629 CCTAACCTTCCCCCCTGGGAATC 0: 1
1: 0
2: 1
3: 12
4: 199
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046929_1062046933 -2 Left 1062046929 9:134428630-134428652 CCCCCGAAAGAGGCTGCGGCTCT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046923_1062046933 10 Left 1062046923 9:134428618-134428640 CCCCTGGGAATCCCCCCGAAAGA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046924_1062046933 9 Left 1062046924 9:134428619-134428641 CCCTGGGAATCCCCCCGAAAGAG 0: 1
1: 0
2: 0
3: 12
4: 1863
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046921_1062046933 12 Left 1062046921 9:134428616-134428638 CCCCCCTGGGAATCCCCCCGAAA 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046930_1062046933 -3 Left 1062046930 9:134428631-134428653 CCCCGAAAGAGGCTGCGGCTCTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046920_1062046933 16 Left 1062046920 9:134428612-134428634 CCTTCCCCCCTGGGAATCCCCCC 0: 1
1: 0
2: 0
3: 36
4: 346
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data
1062046932_1062046933 -5 Left 1062046932 9:134428633-134428655 CCGAAAGAGGCTGCGGCTCTCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1062046933 9:134428651-134428673 CTCACGCACCTGCCTTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062046933 Original CRISPR CTCACGCACCTGCCTTCAGT TGG Intronic
No off target data available for this crispr