ID: 1062046936

View in Genome Browser
Species Human (GRCh38)
Location 9:134428667-134428689
Sequence CAGTTGGATAACCTGCTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062046931_1062046936 12 Left 1062046931 9:134428632-134428654 CCCGAAAGAGGCTGCGGCTCTCA 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046923_1062046936 26 Left 1062046923 9:134428618-134428640 CCCCTGGGAATCCCCCCGAAAGA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046929_1062046936 14 Left 1062046929 9:134428630-134428652 CCCCCGAAAGAGGCTGCGGCTCT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046932_1062046936 11 Left 1062046932 9:134428633-134428655 CCGAAAGAGGCTGCGGCTCTCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046930_1062046936 13 Left 1062046930 9:134428631-134428653 CCCCGAAAGAGGCTGCGGCTCTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046925_1062046936 24 Left 1062046925 9:134428620-134428642 CCTGGGAATCCCCCCGAAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 75
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046922_1062046936 27 Left 1062046922 9:134428617-134428639 CCCCCTGGGAATCCCCCCGAAAG 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046921_1062046936 28 Left 1062046921 9:134428616-134428638 CCCCCCTGGGAATCCCCCCGAAA 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046924_1062046936 25 Left 1062046924 9:134428619-134428641 CCCTGGGAATCCCCCCGAAAGAG 0: 1
1: 0
2: 0
3: 12
4: 1863
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data
1062046928_1062046936 15 Left 1062046928 9:134428629-134428651 CCCCCCGAAAGAGGCTGCGGCTC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1062046936 9:134428667-134428689 CAGTTGGATAACCTGCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062046936 Original CRISPR CAGTTGGATAACCTGCTGTT TGG Intronic
No off target data available for this crispr