ID: 1062046939

View in Genome Browser
Species Human (GRCh38)
Location 9:134428683-134428705
Sequence TGTTTGGTGGCATTCCACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062046934_1062046939 1 Left 1062046934 9:134428659-134428681 CCTGCCTTCAGTTGGATAACCTG 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1062046939 9:134428683-134428705 TGTTTGGTGGCATTCCACGAAGG No data
1062046929_1062046939 30 Left 1062046929 9:134428630-134428652 CCCCCGAAAGAGGCTGCGGCTCT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1062046939 9:134428683-134428705 TGTTTGGTGGCATTCCACGAAGG No data
1062046930_1062046939 29 Left 1062046930 9:134428631-134428653 CCCCGAAAGAGGCTGCGGCTCTC 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1062046939 9:134428683-134428705 TGTTTGGTGGCATTCCACGAAGG No data
1062046932_1062046939 27 Left 1062046932 9:134428633-134428655 CCGAAAGAGGCTGCGGCTCTCAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1062046939 9:134428683-134428705 TGTTTGGTGGCATTCCACGAAGG No data
1062046935_1062046939 -3 Left 1062046935 9:134428663-134428685 CCTTCAGTTGGATAACCTGCTGT 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1062046939 9:134428683-134428705 TGTTTGGTGGCATTCCACGAAGG No data
1062046931_1062046939 28 Left 1062046931 9:134428632-134428654 CCCGAAAGAGGCTGCGGCTCTCA 0: 1
1: 0
2: 1
3: 10
4: 136
Right 1062046939 9:134428683-134428705 TGTTTGGTGGCATTCCACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062046939 Original CRISPR TGTTTGGTGGCATTCCACGA AGG Intronic
No off target data available for this crispr