ID: 1062047584

View in Genome Browser
Species Human (GRCh38)
Location 9:134431646-134431668
Sequence CCCCGCAGGCAGACCCTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062047577_1062047584 5 Left 1062047577 9:134431618-134431640 CCTTAGCACCTCGGTTCCCAGAA 0: 1
1: 0
2: 0
3: 10
4: 116
Right 1062047584 9:134431646-134431668 CCCCGCAGGCAGACCCTAGAGGG No data
1062047575_1062047584 9 Left 1062047575 9:134431614-134431636 CCCTCCTTAGCACCTCGGTTCCC 0: 1
1: 1
2: 1
3: 9
4: 115
Right 1062047584 9:134431646-134431668 CCCCGCAGGCAGACCCTAGAGGG No data
1062047576_1062047584 8 Left 1062047576 9:134431615-134431637 CCTCCTTAGCACCTCGGTTCCCA 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1062047584 9:134431646-134431668 CCCCGCAGGCAGACCCTAGAGGG No data
1062047578_1062047584 -3 Left 1062047578 9:134431626-134431648 CCTCGGTTCCCAGAATAAAGCCC 0: 1
1: 0
2: 2
3: 6
4: 126
Right 1062047584 9:134431646-134431668 CCCCGCAGGCAGACCCTAGAGGG No data
1062047574_1062047584 10 Left 1062047574 9:134431613-134431635 CCCCTCCTTAGCACCTCGGTTCC 0: 1
1: 0
2: 0
3: 11
4: 108
Right 1062047584 9:134431646-134431668 CCCCGCAGGCAGACCCTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062047584 Original CRISPR CCCCGCAGGCAGACCCTAGA GGG Intronic
No off target data available for this crispr