ID: 1062048582

View in Genome Browser
Species Human (GRCh38)
Location 9:134435655-134435677
Sequence GGCTGCACCCCCACTGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062048582_1062048594 17 Left 1062048582 9:134435655-134435677 CCACCTGCAGTGGGGGTGCAGCC No data
Right 1062048594 9:134435695-134435717 CCTGATGCTCTTTGACTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062048582 Original CRISPR GGCTGCACCCCCACTGCAGG TGG (reversed) Intronic