ID: 1062048938

View in Genome Browser
Species Human (GRCh38)
Location 9:134437432-134437454
Sequence TTCTCCTTGCTCTGCGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 153}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062048926_1062048938 0 Left 1062048926 9:134437409-134437431 CCGGCCCCTCCCCAGCCTGAGTC 0: 1
1: 0
2: 10
3: 111
4: 941
Right 1062048938 9:134437432-134437454 TTCTCCTTGCTCTGCGGGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 153
1062048917_1062048938 28 Left 1062048917 9:134437381-134437403 CCCGACTCCCCGTTCAGACCAGA 0: 1
1: 0
2: 1
3: 4
4: 99
Right 1062048938 9:134437432-134437454 TTCTCCTTGCTCTGCGGGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 153
1062048921_1062048938 19 Left 1062048921 9:134437390-134437412 CCGTTCAGACCAGAGTGCCCCGG 0: 1
1: 0
2: 1
3: 6
4: 117
Right 1062048938 9:134437432-134437454 TTCTCCTTGCTCTGCGGGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 153
1062048931_1062048938 -10 Left 1062048931 9:134437419-134437441 CCCAGCCTGAGTCTTCTCCTTGC 0: 1
1: 0
2: 4
3: 31
4: 351
Right 1062048938 9:134437432-134437454 TTCTCCTTGCTCTGCGGGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 153
1062048920_1062048938 20 Left 1062048920 9:134437389-134437411 CCCGTTCAGACCAGAGTGCCCCG 0: 1
1: 0
2: 1
3: 4
4: 61
Right 1062048938 9:134437432-134437454 TTCTCCTTGCTCTGCGGGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 153
1062048928_1062048938 -5 Left 1062048928 9:134437414-134437436 CCCTCCCCAGCCTGAGTCTTCTC 0: 1
1: 0
2: 3
3: 101
4: 879
Right 1062048938 9:134437432-134437454 TTCTCCTTGCTCTGCGGGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 153
1062048925_1062048938 1 Left 1062048925 9:134437408-134437430 CCCGGCCCCTCCCCAGCCTGAGT 0: 1
1: 0
2: 10
3: 109
4: 940
Right 1062048938 9:134437432-134437454 TTCTCCTTGCTCTGCGGGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 153
1062048927_1062048938 -4 Left 1062048927 9:134437413-134437435 CCCCTCCCCAGCCTGAGTCTTCT 0: 1
1: 0
2: 4
3: 70
4: 618
Right 1062048938 9:134437432-134437454 TTCTCCTTGCTCTGCGGGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 153
1062048918_1062048938 27 Left 1062048918 9:134437382-134437404 CCGACTCCCCGTTCAGACCAGAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1062048938 9:134437432-134437454 TTCTCCTTGCTCTGCGGGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 153
1062048924_1062048938 2 Left 1062048924 9:134437407-134437429 CCCCGGCCCCTCCCCAGCCTGAG 0: 1
1: 0
2: 17
3: 109
4: 962
Right 1062048938 9:134437432-134437454 TTCTCCTTGCTCTGCGGGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 153
1062048930_1062048938 -9 Left 1062048930 9:134437418-134437440 CCCCAGCCTGAGTCTTCTCCTTG 0: 1
1: 0
2: 2
3: 49
4: 421
Right 1062048938 9:134437432-134437454 TTCTCCTTGCTCTGCGGGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 153
1062048929_1062048938 -6 Left 1062048929 9:134437415-134437437 CCTCCCCAGCCTGAGTCTTCTCC 0: 1
1: 1
2: 3
3: 50
4: 494
Right 1062048938 9:134437432-134437454 TTCTCCTTGCTCTGCGGGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 153
1062048923_1062048938 10 Left 1062048923 9:134437399-134437421 CCAGAGTGCCCCGGCCCCTCCCC 0: 1
1: 0
2: 7
3: 93
4: 699
Right 1062048938 9:134437432-134437454 TTCTCCTTGCTCTGCGGGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 153
1062048919_1062048938 21 Left 1062048919 9:134437388-134437410 CCCCGTTCAGACCAGAGTGCCCC 0: 1
1: 0
2: 1
3: 10
4: 86
Right 1062048938 9:134437432-134437454 TTCTCCTTGCTCTGCGGGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062048938 Original CRISPR TTCTCCTTGCTCTGCGGGGT GGG Intronic
900862018 1:5240622-5240644 TTTTCCAGGCTCTGTGGGGTAGG - Intergenic
901800172 1:11703943-11703965 ATCTCCTGGCTCTGCAGGGAAGG + Intronic
907761699 1:57367889-57367911 TTCTGCCTGCTCTGAGGAGTGGG - Intronic
908322444 1:62991456-62991478 TTCTCCTTCCTCTGCTGAATTGG + Intergenic
908596149 1:65690757-65690779 TTCCCCTAGCCTTGCGGGGTGGG - Intergenic
910430015 1:87151260-87151282 CTCTCCTTTCTCTACTGGGTAGG + Intronic
914753998 1:150552985-150553007 TGCTCCCAGCCCTGCGGGGTGGG + Exonic
917653977 1:177107479-177107501 TTCTCCTTGCTCTGTGCTGAGGG + Intronic
923869311 1:237973701-237973723 TTCTCCTTGTTCTTTGGGGCTGG + Intergenic
1063378783 10:5571227-5571249 TTCTAATTACTCTGCGAGGTGGG - Intergenic
1064138241 10:12768746-12768768 TTGTCCTTGCACTGCTGCGTGGG - Intronic
1064280414 10:13946195-13946217 TTCTCCTAGCTCTGAGGTGCAGG - Intronic
1064356277 10:14621499-14621521 TTTTCCTTGCCCTGTGGCGTTGG - Intronic
1066044456 10:31583578-31583600 CTGTCCTGGCTCTGCAGGGTGGG + Intergenic
1069118617 10:64539381-64539403 GTCTCCCTTCTCTGCAGGGTAGG - Intergenic
1070690635 10:78522348-78522370 TTCTCCTTGCTATTTGGTGTAGG - Intergenic
1073292444 10:102419919-102419941 TTCTCGCTGCCTTGCGGGGTGGG + Exonic
1076489473 10:130847736-130847758 TGCCCCTTGCTCTGTGGGGGCGG - Intergenic
1076710338 10:132330415-132330437 CTCTCCTTGCTCTGCCCGGGTGG + Intronic
1077016322 11:400523-400545 TTCTCCACGCTCTGCGGGCGGGG - Exonic
1077087269 11:760055-760077 TCCAGCTTGCTCTGCGTGGTGGG + Intronic
1077246466 11:1541682-1541704 TTCTCCAGGCTCTGCAGCGTAGG - Intergenic
1077276580 11:1713952-1713974 TGCCCCTTGCTTTGCGAGGTAGG - Intergenic
1077481187 11:2815436-2815458 CTCTCCTGGCCCTGTGGGGTCGG + Intronic
1078222576 11:9364135-9364157 TCCTCCTTGCGCTGGGGGGTGGG + Intergenic
1081890978 11:46542350-46542372 TTCTCACTGCTGTGTGGGGTGGG + Exonic
1083184734 11:61010886-61010908 TCCTCCTTACTGTGGGGGGTGGG + Intronic
1083769055 11:64856231-64856253 TGCTCCCTGCTCTGCTGCGTGGG - Intronic
1084312638 11:68325748-68325770 TGCTCCTAGCTCTGCGGTCTGGG + Intronic
1087441805 11:98194143-98194165 TTCTCCTTGCCCTGTGTTGTAGG - Intergenic
1089676108 11:120090770-120090792 TCCTCCTGGCCCTGTGGGGTTGG - Intergenic
1091800778 12:3323307-3323329 CTCTCCATGCTCTGCAGGGAGGG - Intergenic
1093116656 12:15220603-15220625 TTCTACTTCCTCTTGGGGGTGGG + Intronic
1093401738 12:18754308-18754330 TTCTCCTCTCTCTGCCGGCTGGG + Intergenic
1093493157 12:19726753-19726775 TTCTGCCTGCTCTGTGGAGTGGG + Intergenic
1094798220 12:34000808-34000830 CTCTCATTGCTCTGAGGGATAGG - Intergenic
1095302355 12:40599445-40599467 TTCTCCTTATTTTGGGGGGTGGG + Intergenic
1095654098 12:44649137-44649159 TTCTCCTTAATCTGCTTGGTTGG - Intronic
1096801564 12:54113937-54113959 TTCTCCTTGTTCTCCCGGGATGG + Intergenic
1096912972 12:55002615-55002637 TTCTCATTGCTCAGAGTGGTTGG - Intergenic
1097106641 12:56629944-56629966 GTCTCCTTGCTCTGGGGTCTGGG - Intronic
1097246009 12:57607978-57608000 TGCTCCTGGCTCTGTTGGGTTGG - Intronic
1100313894 12:93425598-93425620 TTTTCCTTACTCTGTGGGGTTGG - Intronic
1102498165 12:113333665-113333687 CTCTCCCTGCTGTGCAGGGTGGG - Intronic
1104180389 12:126374115-126374137 CTCTCCTTGTTCTGTGGGGAGGG - Intergenic
1109221356 13:59643964-59643986 TTTTCCATCCTCTGCTGGGTGGG - Intergenic
1109881272 13:68480496-68480518 TTCTTCTTGCTCTGAGTAGTTGG - Intergenic
1119689982 14:76663961-76663983 TTGACCTTGCTGTGCTGGGTGGG - Intergenic
1120282987 14:82463258-82463280 TTCTTCTTTCTCTGCGGGCTGGG - Intergenic
1126525033 15:49644502-49644524 TGCTCCCTGCTCTGTGAGGTAGG + Exonic
1127641873 15:60923789-60923811 TTTTCCTGGCTCTTCTGGGTGGG - Intronic
1128606131 15:69037881-69037903 TTCCCCATGGCCTGCGGGGTTGG - Intronic
1131070003 15:89460213-89460235 ATCTCCTAGCTCTGTGGCGTTGG + Intergenic
1132060559 15:98688956-98688978 TCCTCCTTCCTCTGTGTGGTGGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1134078525 16:11308946-11308968 TTCTGCCTGCTCTGTGGGGTGGG + Intronic
1135934967 16:26771766-26771788 TGCTCCTTGCTCTGCTTGGAAGG + Intergenic
1143544589 17:7588803-7588825 CTCTCCTTGCCCTGGGGGCTGGG + Intronic
1147911408 17:43858337-43858359 GCCTCCTGGCTCTGCGGGCTAGG + Intronic
1148897739 17:50849710-50849732 ATCTCCTTGCTATCCAGGGTGGG + Intergenic
1149575920 17:57713343-57713365 TTCTCCTTGCTGGCCGGCGTGGG - Intergenic
1152940489 17:83169915-83169937 TTCTCCTTGCTTTTCGGTTTGGG + Intergenic
1153528701 18:6021749-6021771 TTCTCCTGGTGCAGCGGGGTGGG + Intronic
1154375481 18:13805737-13805759 TTCTCTTTGCTTTGCAGTGTGGG - Intergenic
1157557083 18:48619862-48619884 TTCTGGGTGCTCTGCTGGGTGGG - Intronic
1157658893 18:49421017-49421039 TTCTCCTTGAGCTGCGGTTTGGG - Intronic
1157785093 18:50474432-50474454 TTCTCCTGGCTCTTTGGTGTGGG + Intergenic
1157822581 18:50784550-50784572 TTCTCCTTGCTTTCCTGGGCTGG - Intergenic
1160013369 18:75123330-75123352 TTCCCATTGTTCCGCGGGGTTGG - Intergenic
1161039234 19:2101260-2101282 GTCTCCTTGCCCTGCCTGGTGGG + Exonic
1163221881 19:15927584-15927606 TTCTTCCTGCTATGCTGGGTGGG - Intronic
1163516917 19:17770413-17770435 TCCTCCTTGCACTGCGGGGTAGG - Exonic
1166006848 19:39914030-39914052 ATGACCTGGCTCTGCGGGGTGGG - Exonic
1166931009 19:46301246-46301268 ATCCCCTTGCCCTGGGGGGTGGG + Intronic
1167574320 19:50310436-50310458 TTCTGGTTGCTCTGAGGGTTCGG + Exonic
926974137 2:18496208-18496230 TTCTCCTTTTTTTGCTGGGTAGG - Intergenic
927692278 2:25216381-25216403 TTCTCCTGAGTCTGCGGGGCGGG + Intergenic
927834543 2:26382960-26382982 TTCTCAAAGCTCTGTGGGGTTGG + Intronic
930160576 2:48152394-48152416 TTCTTCTTGCTTTGGGAGGTTGG + Intergenic
931598834 2:63981380-63981402 TTCTCCTTGGTAAGCAGGGTAGG + Intronic
931905056 2:66833578-66833600 TTTTCCTTACTCTGCTGGATGGG + Intergenic
933418984 2:82023663-82023685 TTCTGCTTGGTCTGTGTGGTCGG + Intergenic
933583381 2:84152487-84152509 TAGACCTTGCCCTGCGGGGTGGG + Intergenic
934989997 2:98914287-98914309 TGCTCCTTGCTGTGGGGGGCTGG - Intronic
935246538 2:101223761-101223783 GTCTCCCTGCTCTGGGGAGTGGG + Intronic
947217401 2:227761732-227761754 TTGTCCTTGTTCTGCGGCTTAGG + Intergenic
947416882 2:229905782-229905804 CTCTCCTTGCTCTGATTGGTGGG - Intronic
947659059 2:231853211-231853233 CTCACCGTGCTCTGGGGGGTGGG - Intergenic
948244059 2:236463249-236463271 TTCTCCTTGCTTTCTGGGGATGG - Intronic
1171318366 20:24216191-24216213 TTCTCTTTGCTTTGCAGTGTTGG - Intergenic
1171795135 20:29560529-29560551 TTCTCCTTGTTCTCCCGGGATGG - Intergenic
1174213797 20:48900533-48900555 TTCTCCCTGTTCTTCGAGGTTGG - Intergenic
1174419634 20:50391156-50391178 TTGTGCCTGCTCTGCTGGGTGGG - Intergenic
1174814893 20:53678176-53678198 TTCTCCTGTGTGTGCGGGGTGGG + Intergenic
1175804283 20:61818850-61818872 TTCTGCTTGGACTGCCGGGTGGG - Intronic
1177296105 21:19177768-19177790 TTCTCATCGTTCTACGGGGTGGG + Intergenic
1178409805 21:32353769-32353791 TGCTCCTAGCTCTGCTGGCTGGG + Intronic
1179014094 21:37579977-37579999 TTATCCTTGCTCTGCTGGAGTGG + Intergenic
1179512648 21:41884108-41884130 TTGTCCTTGCTCTGCTAGGTGGG + Intergenic
1179731953 21:43373031-43373053 TTCACCTGGCTCTGAGGGTTTGG - Intergenic
1181349443 22:22244720-22244742 TCCTCCCTGCTCTGAGAGGTGGG - Exonic
1181960171 22:26617054-26617076 GTCTGCTTCCTCTGAGGGGTTGG + Intronic
949695379 3:6688525-6688547 GTCTCCTTTCTCTGTGGGTTGGG - Intergenic
955226778 3:57066808-57066830 TTCTTCCTGCTCTGGGAGGTCGG - Intronic
955369236 3:58336808-58336830 TTCTCCTTTTTTTGGGGGGTGGG + Intronic
957624347 3:82640434-82640456 TTCTGCCTGCTCTGTGGAGTAGG - Intergenic
960339988 3:116463011-116463033 ATGTCCTTGCTCTACGGTGTTGG - Intronic
962084378 3:132174557-132174579 TGCTTCTTGCTCTGTGGGGGTGG - Intronic
964657102 3:159079315-159079337 ATCTTCTTGCTCTGGGGAGTTGG + Intronic
966634700 3:182119106-182119128 TCCTCCTTACTCTACTGGGTGGG + Intergenic
966852858 3:184175267-184175289 TTGTCCTTGCGCGGAGGGGTAGG - Intronic
966919264 3:184601740-184601762 TTCCCCTTGCTCTGCGGGCTGGG - Intronic
967849178 3:194069765-194069787 TTCTCCTGGCTCTGGAGGCTGGG - Intergenic
968756116 4:2417463-2417485 CTCTCCTAGCGCCGCGGGGTCGG - Intronic
970756419 4:19431968-19431990 TTCTCTTTGCTCTTCGGTTTTGG - Intergenic
972128483 4:35800891-35800913 TTCTGCCTGCTCTGTGGTGTGGG - Intergenic
974096307 4:57368357-57368379 TTCTCATAGCTCTGGAGGGTGGG + Intergenic
975348227 4:73318573-73318595 TTCTGCCTGCTCTGCGGAGCTGG + Intergenic
979022954 4:115525574-115525596 TTCTACTTGCTCTCCGTGGGTGG + Intergenic
979635770 4:122953116-122953138 TACTACTTGCTGTGTGGGGTTGG + Intronic
981348796 4:143704518-143704540 TTCTCCATGCCCTCCGGGATGGG + Intergenic
983553750 4:169041634-169041656 TTTTCCTTGCTCTGCAGGACGGG + Intergenic
988439059 5:31211272-31211294 CTTTCCATGCTCTGTGGGGTGGG + Intronic
988495053 5:31737698-31737720 TTCTCCTTCCTCTGGTGGGGAGG + Intronic
988988370 5:36644136-36644158 ATCTCTTTGCTATGGGGGGTGGG - Intronic
994352539 5:98763415-98763437 TTCCCCTGGCCCTGGGGGGTAGG - Intergenic
994449451 5:99923590-99923612 TTCTGATTGCTCTTCTGGGTTGG + Intergenic
996576812 5:124984556-124984578 TTCTCCTTCCTCTGCAGAGCTGG + Intergenic
999303849 5:150507561-150507583 TTCTTCCTTCTCTGCAGGGTGGG + Intronic
999511824 5:152260151-152260173 TTCTCAATGTTCTGCTGGGTGGG - Intergenic
999697174 5:154197426-154197448 TTCTGCTTGCTGTGGTGGGTGGG + Intronic
1002459836 5:179367831-179367853 CACTCCTTGCTGTGCGGGGAGGG - Intergenic
1002569163 5:180130265-180130287 GCCTGCTTCCTCTGCGGGGTAGG + Intronic
1004072437 6:12312981-12313003 TTCTCCTTGCAATATGGGGTTGG - Intergenic
1006553483 6:34845301-34845323 TTCTCTTTGCTCAGCTGGCTTGG + Intronic
1006984708 6:38168891-38168913 TTCTCCAGGCACTGGGGGGTGGG + Exonic
1011294472 6:85811204-85811226 TTCTCCTACCTCTGCTGGCTGGG + Intergenic
1011777538 6:90748438-90748460 GACTCCATGCTCTGTGGGGTTGG + Intergenic
1012652751 6:101777340-101777362 TCCTTCTTGCTCAGAGGGGTGGG + Intronic
1019759945 7:2803511-2803533 CTCTCCGTGCTCTGCAGGTTTGG - Intronic
1023264510 7:38391958-38391980 TTCTCCTTCCTCTTCATGGTTGG + Exonic
1023367062 7:39474974-39474996 TCCTCCCAGCTCTGGGGGGTAGG - Intronic
1023539445 7:41249978-41250000 CTCTCCTTCCTCTGGAGGGTAGG - Intergenic
1026582835 7:71632414-71632436 TTCTCCTTTCTTTGAGGGCTAGG - Intronic
1026854322 7:73743075-73743097 TTGTCCCTGCTCAGCGGGGCAGG - Intergenic
1029207031 7:98875838-98875860 TTCGCCTGGCTCTGGGGGGGCGG + Intergenic
1033407853 7:141088073-141088095 TTCTTGATGCTCTGCGGGGAGGG + Intronic
1035109797 7:156471587-156471609 CTGTCCTTGCTCTACGGGCTGGG - Intergenic
1038575103 8:28698397-28698419 TGCTCCATGCTCTGTGGTGTTGG + Intronic
1040547480 8:48410024-48410046 TTCTCCTTGCTCTGCTGTCAGGG + Intergenic
1048223851 8:132566422-132566444 GGCTTCCTGCTCTGCGGGGTTGG + Intergenic
1048619195 8:136113218-136113240 TTCTCATAGCTCTGGGGGCTGGG - Intergenic
1049058698 8:140259022-140259044 TGCTGCTTCCTCCGCGGGGTGGG - Intronic
1049559806 8:143304322-143304344 TTCTCCCAGCTCTGCAGGCTGGG + Intergenic
1051725815 9:20087821-20087843 TTCTCCATTCTCTGTGGGTTGGG - Intergenic
1053791120 9:41687035-41687057 TTCTCCTTGCTCTCCCGGGATGG + Intergenic
1054154033 9:61627737-61627759 TTCTCCTTGCTCTCCCGGGATGG - Intergenic
1054179466 9:61898729-61898751 TTCTCCTTGCTCTCCCGGGATGG + Intergenic
1054473817 9:65558857-65558879 TTCTCCTTGCTCTCCCGGGATGG - Intergenic
1054658072 9:67682092-67682114 TTCTCCTTGCTCTCCCGGGATGG - Intergenic
1055246019 9:74243925-74243947 TTATCCTTGCTATGCAAGGTTGG - Intergenic
1057223270 9:93269115-93269137 TTCTGCTTGCTTTGGGGGGTGGG + Intronic
1061499819 9:130995406-130995428 TTGTCCTTGCTCAGAGGGGCAGG + Intergenic
1062048938 9:134437432-134437454 TTCTCCTTGCTCTGCGGGGTGGG + Intronic
1062589820 9:137268607-137268629 TTCTCCCAGTTCTGCGGGCTGGG + Intronic
1190285909 X:48961346-48961368 ATCTCCTGGCTCTGTGGGTTTGG - Intergenic
1200230585 X:154441987-154442009 TGCTACCTGCTCTGCGGGGCTGG + Intronic