ID: 1062049044

View in Genome Browser
Species Human (GRCh38)
Location 9:134437837-134437859
Sequence GTGGACAATACCAGGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062049044_1062049050 9 Left 1062049044 9:134437837-134437859 CCACCCAGCCTGGTATTGTCCAC 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1062049050 9:134437869-134437891 TGTTCACCCAGAGCCTTACTTGG 0: 1
1: 0
2: 0
3: 10
4: 106
1062049044_1062049051 10 Left 1062049044 9:134437837-134437859 CCACCCAGCCTGGTATTGTCCAC 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1062049051 9:134437870-134437892 GTTCACCCAGAGCCTTACTTGGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062049044 Original CRISPR GTGGACAATACCAGGCTGGG TGG (reversed) Intronic
901797030 1:11685667-11685689 GTGCACAATGCCAGGCATGGTGG + Intronic
902698780 1:18157591-18157613 GTGTACCAGACCGGGCTGGGAGG - Intronic
903772359 1:25771927-25771949 GTGTAAAATGCCTGGCTGGGAGG - Intronic
905204499 1:36335509-36335531 GTGGACAGTTGGAGGCTGGGCGG - Intergenic
905700960 1:40013549-40013571 GTGGAAAATGCAAAGCTGGGTGG - Intergenic
907128001 1:52069112-52069134 GAAGACAACACCAGGATGGGGGG - Intronic
907568276 1:55457701-55457723 GTGCAAAATGCCAGGTTGGGTGG + Intergenic
912226344 1:107738534-107738556 GTAGACAATAGCAGGCTAGTTGG - Intronic
923544736 1:234915944-234915966 GTAGACAGAAGCAGGCTGGGAGG + Intergenic
1064004598 10:11689998-11690020 GTGGGCAGCAGCAGGCTGGGGGG + Intergenic
1065125426 10:22569182-22569204 GGAGCCAAGACCAGGCTGGGGGG + Intronic
1069433319 10:68356834-68356856 GTGGAAAATGCCAGGCTTGGTGG - Intronic
1071225847 10:83526924-83526946 GGGGATTGTACCAGGCTGGGTGG - Intergenic
1074349578 10:112722993-112723015 GTGGACAAAGCCAGGCTGTCTGG - Intronic
1074998580 10:118778688-118778710 GGAGACTCTACCAGGCTGGGTGG + Intergenic
1079444271 11:20545559-20545581 GTGGACAATCCCAGGGCTGGGGG - Intergenic
1081714111 11:45236385-45236407 GAGGACAAGATGAGGCTGGGAGG - Intergenic
1081795937 11:45819565-45819587 GTGGACTAAAACAGGCTGTGTGG - Intergenic
1082049687 11:47760719-47760741 ATAGAAAAGACCAGGCTGGGTGG - Intronic
1083296907 11:61719869-61719891 GTGGCCAGTACCAGTCTCGGGGG + Intronic
1084494382 11:69495631-69495653 GGGGACAACCCCAGGCTGGATGG - Intergenic
1085537610 11:77232949-77232971 GTGGGCAACACAGGGCTGGGGGG + Intronic
1088607573 11:111546091-111546113 GTGGCTAATAACAGGCTGGCTGG + Intronic
1089334947 11:117716819-117716841 GTGGACAATACATGGGTGAGCGG - Intronic
1089455817 11:118625199-118625221 GTGGAGAATGCCAGGCAGTGGGG + Intronic
1090875032 11:130781360-130781382 GTCAACAAAGCCAGGCTGGGAGG + Intergenic
1096526263 12:52212045-52212067 GTGGAGCAGACCAGCCTGGGAGG - Intergenic
1098087809 12:66866261-66866283 GTGTTCATGACCAGGCTGGGTGG + Intergenic
1099788310 12:87296179-87296201 GTGGACAATAGCAGGAGGGAGGG + Intergenic
1101287037 12:103325448-103325470 GTGGCCAAAAGCAGTCTGGGAGG - Intronic
1104903435 12:132201414-132201436 GTGGATATTAGGAGGCTGGGGGG - Intronic
1105688031 13:22805721-22805743 GTGGAAAAGGCCTGGCTGGGAGG - Intergenic
1106509766 13:30402800-30402822 GTAGATAAAACCATGCTGGGAGG + Intergenic
1106949436 13:34866691-34866713 CTGAAAAATACTAGGCTGGGCGG - Intergenic
1108373105 13:49790638-49790660 GTGACCAATACCAGGCTGAATGG + Intronic
1111490854 13:88972879-88972901 GTAGATTATACCAGGCTGAGTGG + Intergenic
1112357543 13:98686596-98686618 GAAGACTATGCCAGGCTGGGTGG - Intronic
1113550077 13:111185885-111185907 GTGGGCAAAGCCAGGCTGGTGGG + Intronic
1117517667 14:56518542-56518564 ATGGAAAATACCTGGATGGGTGG - Intronic
1117559582 14:56923067-56923089 GTGTGCAATGCCAGGCTGGGAGG + Intergenic
1117863647 14:60121788-60121810 CTTGACAAGAGCAGGCTGGGTGG - Intronic
1117992485 14:61448482-61448504 GAGGGCATTACAAGGCTGGGTGG + Intronic
1120738211 14:88078873-88078895 GTGGAAAGTACCATGGTGGGGGG - Intergenic
1121307913 14:92918358-92918380 CTGTAAAATACCAGGGTGGGAGG - Intergenic
1121999244 14:98632963-98632985 TAGGACAATACCAGGCAGTGGGG + Intergenic
1122047714 14:99035483-99035505 GAGGACAGAGCCAGGCTGGGAGG + Intergenic
1122325854 14:100880306-100880328 GTGGCCATCACCAGGCCGGGTGG + Intergenic
1122865390 14:104601688-104601710 CTGGAAAAGAGCAGGCTGGGCGG + Intronic
1124086841 15:26559025-26559047 GAGGACAGAACCAGGCAGGGTGG + Intronic
1124106931 15:26747133-26747155 GAGGAGAATCCCAGTCTGGGAGG - Intronic
1127811987 15:62572908-62572930 GAGGACAGCACAAGGCTGGGAGG - Intronic
1127978758 15:64018553-64018575 GTGGCCATTTCCAGTCTGGGAGG - Intronic
1128082421 15:64864577-64864599 CTGGACTATACAAGCCTGGGTGG - Intronic
1131228246 15:90642631-90642653 GGGGACATTCCCAGGCTGAGTGG + Exonic
1133011315 16:2913388-2913410 CTGGGGAATACCGGGCTGGGGGG + Intronic
1134900813 16:17936231-17936253 GGGGACAAAACCACCCTGGGTGG - Intergenic
1141530381 16:84642395-84642417 GTGGGCAATGCCAGCCTGGCTGG + Intergenic
1143400468 17:6639537-6639559 GTGGACAGGGACAGGCTGGGAGG - Intronic
1147189295 17:38729663-38729685 ATGCACAATTCCAGGCTTGGAGG - Exonic
1149029190 17:52064695-52064717 ATGGAAAATAGCAAGCTGGGAGG + Intronic
1150470322 17:65431780-65431802 CTGGACCACACCAGGATGGGAGG - Intergenic
1150499254 17:65634557-65634579 CTGAACATTACCAGGCTGAGTGG + Intronic
1151477517 17:74352427-74352449 GGGGACAGGACCAGGCTGGCTGG + Intronic
1151651426 17:75472401-75472423 CTGGGCCAAACCAGGCTGGGAGG - Intronic
1153397368 18:4639779-4639801 GTGGTCAATGCCAAACTGGGAGG + Intergenic
1153448888 18:5204517-5204539 GAGGACAATACCAGGCCATGAGG - Intergenic
1161200757 19:3013547-3013569 GTGGACAATGCCAGCCCGGCTGG + Intronic
1161405052 19:4086797-4086819 GATGAAAATACCAAGCTGGGGGG + Intergenic
1162917118 19:13880595-13880617 GGGCTCAATCCCAGGCTGGGGGG - Intronic
1163348783 19:16762177-16762199 GTGAGCAATGCCAGGCAGGGTGG - Intronic
1167663734 19:50811547-50811569 GAGGACCATCCCAGGCAGGGAGG + Intergenic
1167663805 19:50811813-50811835 GAGGACCATCCCAGGCAGGGAGG + Intergenic
1167663836 19:50811927-50811949 GAGGACCATCCCAGGCAGGGAGG + Intergenic
1167663847 19:50811965-50811987 GAGGACCATCCCAGGCAGGGAGG + Intergenic
1167663854 19:50811984-50812006 GAGGACCATCCCAGGCAGGGAGG + Intergenic
1167663885 19:50812079-50812101 GAGGACCATCCCAGGCAGGGAGG + Intergenic
1167663898 19:50812117-50812139 GAGGACCATCCCAGGCAGGGAGG + Intergenic
927516056 2:23672255-23672277 GGGGACAATCCCAAGATGGGGGG - Intronic
929894040 2:45942930-45942952 GTGGAGAATAAGAGGTTGGGGGG - Intronic
933164886 2:79064997-79065019 CAGGACAGTACCAGGCAGGGTGG + Intergenic
937127374 2:119483095-119483117 CTGGACAATGCCTGGCTGGTTGG + Intronic
943334935 2:186602059-186602081 TTCCACAATCCCAGGCTGGGTGG - Exonic
947739929 2:232480367-232480389 GTGGACAAGGCCAGGCGGGCAGG + Intronic
1168811206 20:705812-705834 GTGGACATTCCAGGGCTGGGTGG + Intergenic
1169075231 20:2756012-2756034 GGTGACCATCCCAGGCTGGGAGG - Intronic
1170359720 20:15532780-15532802 AAGGACAACACCAGGATGGGGGG - Intronic
1170480954 20:16764434-16764456 GTGGACACTACAGGGCTGAGAGG - Intronic
1172520361 20:35561942-35561964 GGGGACAGGACCAGGCTGGAGGG + Intergenic
1173868924 20:46329974-46329996 CAGGACCATGCCAGGCTGGGAGG + Intergenic
1175256713 20:57652306-57652328 ATGGATAGTGCCAGGCTGGGCGG - Exonic
1176705628 21:10118599-10118621 GTGGACAATAAGCGCCTGGGAGG + Intergenic
1180078171 21:45473665-45473687 GTGGAAAGCACCCGGCTGGGCGG - Intronic
1180922445 22:19528001-19528023 GTGGACAGTGCCAGACTCGGCGG + Intergenic
1182419300 22:30241187-30241209 GGGGCCAAGTCCAGGCTGGGTGG + Exonic
1183948724 22:41340888-41340910 GTGGACACACTCAGGCTGGGAGG + Intronic
1184185487 22:42862056-42862078 ACGGACAATACTGGGCTGGGTGG - Intronic
1185364810 22:50432589-50432611 GAGGGCAAAGCCAGGCTGGGCGG - Intronic
954258501 3:49422375-49422397 GTGGACGACACAAGGCCGGGGGG + Exonic
955399037 3:58578070-58578092 GTGGAGCATACCAGGGTGGTTGG + Intronic
955644902 3:61126769-61126791 GGGGAGAGTACCAGGGTGGGTGG + Intronic
956642859 3:71431038-71431060 GTGGACAGAACCAGGCAGGGAGG + Intronic
964853000 3:161115274-161115296 GTGGACAGCACCAAGCTGTGAGG + Intronic
966496826 3:180590548-180590570 GTTCACACTGCCAGGCTGGGCGG + Intergenic
968642842 4:1722896-1722918 CGGGACAAGACCAGGCTGAGAGG - Intronic
969071851 4:4546086-4546108 ATGGAAAAGACCAGGCTGGCAGG + Intergenic
970176108 4:13340959-13340981 GTGGGTAGTACCAAGCTGGGAGG + Intergenic
970193339 4:13534797-13534819 TTGGAGATTACCAGGCTGCGTGG - Intergenic
971349372 4:25842898-25842920 GTGGACAATGACAGGCAGGGCGG + Intronic
977989669 4:103425601-103425623 GTGGAAAATTCCAGGCTAGGAGG + Intergenic
979104260 4:116664417-116664439 GTGCCCAACAGCAGGCTGGGTGG + Intergenic
984104505 4:175528195-175528217 CAGGACAATACCAGACTGAGAGG - Intergenic
985956488 5:3269600-3269622 GTGTGCACTACCAGGCTGGCTGG + Intergenic
986003330 5:3647567-3647589 GTGGACAAAACATGGCTGTGGGG - Intergenic
989566808 5:42909272-42909294 GTGGATACTAACAGGGTGGGAGG - Intergenic
992635927 5:78726008-78726030 GGGGACAAAACTAGGTTGGGTGG + Intronic
995613551 5:113936519-113936541 GTGCTCAATACCAGGCAGGGAGG + Intergenic
995811421 5:116110861-116110883 GAGGACAATACCAAGAGGGGTGG + Intronic
1002817483 6:693705-693727 GGGGACTGTACCAGGTTGGGGGG + Intergenic
1005276981 6:24229951-24229973 GTGGCCAAGAGCAGGCTGGGTGG - Intronic
1006482509 6:34308369-34308391 GTGGACAACTTGAGGCTGGGAGG + Intronic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1008084790 6:47233095-47233117 ATGGAGAATAATAGGCTGGGGGG - Intronic
1013962655 6:115918964-115918986 TTGGACAATAGAAGGATGGGGGG - Intergenic
1015225146 6:130849160-130849182 GTGGCCAGCATCAGGCTGGGAGG - Intronic
1017794833 6:157834633-157834655 GTGGACACTAACAGTTTGGGAGG - Intronic
1020084386 7:5302772-5302794 GTGGACAACACCAGCCTGAGGGG - Intronic
1020380659 7:7541980-7542002 GTTGACAATACCATGCTGCAGGG + Intergenic
1024588469 7:50860793-50860815 GAGGACAAGCCCAGGCTGGCAGG - Intergenic
1024905238 7:54371894-54371916 GTGGATAAATCCTGGCTGGGAGG + Intergenic
1025858987 7:65308899-65308921 GTGGACACTCTCAGGCTGGGTGG + Intergenic
1027218096 7:76197085-76197107 GGGGAAATTAGCAGGCTGGGTGG + Intergenic
1032352372 7:131176946-131176968 CTGGAAAATGCTAGGCTGGGAGG + Intronic
1036590704 8:10165505-10165527 GGGGCTAAGACCAGGCTGGGTGG + Intronic
1036752135 8:11450017-11450039 GTGGAGAATGCGAGGCTGGAAGG - Intronic
1037879831 8:22567107-22567129 GTGGACAAGAACTGGCTGGAGGG + Exonic
1039395361 8:37220918-37220940 ATGGACACTGCCAGGCTGGTAGG + Intergenic
1049009362 8:139876981-139877003 GAGGGCAACACCAGCCTGGGAGG - Intronic
1049092527 8:140527038-140527060 CTGGACTGTCCCAGGCTGGGTGG + Intergenic
1049615690 8:143574977-143574999 CTGCACAGTACCAGGTTGGGGGG - Exonic
1051588673 9:18753475-18753497 GTGCAGGGTACCAGGCTGGGGGG - Exonic
1053394173 9:37757370-37757392 GAGGAAAATACCAAGCTGGCTGG - Intronic
1055395823 9:75873943-75873965 GAGGACAGTACCAAGGTGGGTGG + Intergenic
1059074073 9:111171590-111171612 ATGGACAATACCAGGCTAGAAGG + Intergenic
1062049044 9:134437837-134437859 GTGGACAATACCAGGCTGGGTGG - Intronic
1202790661 9_KI270719v1_random:88708-88730 GTGGACAATAAGCGCCTGGGAGG + Intergenic
1186184659 X:7008448-7008470 GTGGTCAACACCAGGGTGGGTGG + Intergenic
1186250307 X:7658824-7658846 ATGGACAAGACCAGGATGGACGG - Intergenic
1186391121 X:9160382-9160404 CTGGACAATACTAGGCTGGGGGG + Intronic
1189144525 X:38642297-38642319 GTGGACAATACCATCATGAGAGG + Intronic
1196102796 X:111865224-111865246 GAGTTCAAGACCAGGCTGGGGGG - Intronic
1196783308 X:119401314-119401336 GAGGACAATGCCAGGATGGAAGG + Intronic
1198081738 X:133246503-133246525 GTGGACAATACAGGGTTGGATGG + Intergenic
1199710317 X:150464392-150464414 CTGGAGAATACCAGGGTGGTTGG - Intronic