ID: 1062049442

View in Genome Browser
Species Human (GRCh38)
Location 9:134439473-134439495
Sequence GCTTCCAGGGTGCGGAGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 422}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062049442_1062049448 -10 Left 1062049442 9:134439473-134439495 CCGGCCCTCCGCACCCTGGAAGC 0: 1
1: 0
2: 2
3: 44
4: 422
Right 1062049448 9:134439486-134439508 CCCTGGAAGCACACGGCCTCTGG 0: 1
1: 0
2: 2
3: 35
4: 704
1062049442_1062049453 12 Left 1062049442 9:134439473-134439495 CCGGCCCTCCGCACCCTGGAAGC 0: 1
1: 0
2: 2
3: 44
4: 422
Right 1062049453 9:134439508-134439530 GGAAGGACAGCCCTGACCTTCGG 0: 1
1: 0
2: 1
3: 20
4: 233
1062049442_1062049450 -9 Left 1062049442 9:134439473-134439495 CCGGCCCTCCGCACCCTGGAAGC 0: 1
1: 0
2: 2
3: 44
4: 422
Right 1062049450 9:134439487-134439509 CCTGGAAGCACACGGCCTCTGGG 0: 1
1: 0
2: 1
3: 11
4: 185
1062049442_1062049451 -5 Left 1062049442 9:134439473-134439495 CCGGCCCTCCGCACCCTGGAAGC 0: 1
1: 0
2: 2
3: 44
4: 422
Right 1062049451 9:134439491-134439513 GAAGCACACGGCCTCTGGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 174
1062049442_1062049456 26 Left 1062049442 9:134439473-134439495 CCGGCCCTCCGCACCCTGGAAGC 0: 1
1: 0
2: 2
3: 44
4: 422
Right 1062049456 9:134439522-134439544 GACCTTCGGTTTTCCGAGCACGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062049442 Original CRISPR GCTTCCAGGGTGCGGAGGGC CGG (reversed) Intronic
900163884 1:1237069-1237091 GCAGGGAGGGTGCGGAGGGCAGG - Intergenic
901292806 1:8137358-8137380 GCTTGCAGGGAGCGGAGATCAGG + Intergenic
901510452 1:9715828-9715850 GCCTGCGGGGTGGGGAGGGCTGG - Exonic
902458731 1:16554920-16554942 ACTTCCAGGGTGCACAGGGCAGG + Intergenic
902493426 1:16852996-16853018 ACTTCCAGGGTGCACAGGGCAGG - Intronic
902701022 1:18172066-18172088 GCTTACAGGCTGAGGAGGGCAGG + Intronic
903151920 1:21415679-21415701 ACTTCCAGGGTGCACAGGGCAGG + Intergenic
903270133 1:22183020-22183042 GCATCCAGGGTGGTGGGGGCGGG + Intergenic
903469137 1:23573171-23573193 GATTCCAGGGTGGGGGGGTCAGG - Intergenic
903669681 1:25028102-25028124 GCCTCCAGGGGGCAGAGGTCTGG + Intergenic
903681965 1:25103252-25103274 GCTTCCAGGGAGCAGGGAGCTGG - Intergenic
903941949 1:26938092-26938114 CCAACCAGGGTGGGGAGGGCTGG - Intronic
904237594 1:29124686-29124708 GTTTCCATGATGCGGGGGGCGGG + Intergenic
905663459 1:39746561-39746583 GCTACCAGGTTGGGGAGGGGTGG + Intronic
905720935 1:40201077-40201099 GCTCCCAGGTTGCGGGGGGGGGG - Intronic
905974073 1:42162863-42162885 GCTTCCCTGCTGCGGAGGGGAGG + Exonic
906034135 1:42740346-42740368 GCCCCCTGGGGGCGGAGGGCCGG + Intergenic
908260179 1:62334257-62334279 GATGCCAGGGTGCAGTGGGCTGG + Intergenic
908331327 1:63073990-63074012 GCTCCCAGGGTGCGCACGGCCGG - Intergenic
908379551 1:63583297-63583319 CCTTCAAGGCTGCGGAGGGTAGG - Intronic
910077618 1:83299092-83299114 GCTACCAGGGTGGGGAGGGGAGG - Intergenic
910738972 1:90494610-90494632 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
912233085 1:107818100-107818122 GTTTCCAGAGTGAGGAGAGCAGG + Intronic
913143142 1:115961967-115961989 GCTACCAGGGTGGGTAGGGGAGG - Intergenic
913151333 1:116046972-116046994 GCTACCAGGGTGGGGAGGGAAGG - Intronic
913339720 1:117746939-117746961 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
914455528 1:147833241-147833263 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
914884665 1:151575039-151575061 GGTTGCAGGGAGGGGAGGGCAGG + Intronic
915367844 1:155325379-155325401 GCCACCAGGGCGTGGAGGGCCGG - Exonic
915895282 1:159807227-159807249 ACTTCCAGGGTGAGGAGAGTGGG + Intronic
917981426 1:180271998-180272020 GCTTCCGAGGTGAGCAGGGCTGG + Exonic
918158380 1:181872818-181872840 GCTACCAGGGTGAGTAGGGAAGG - Intergenic
919397454 1:197068859-197068881 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
919763808 1:201114124-201114146 GCTTCCTGGGTTGGGAGGGGGGG - Exonic
920290608 1:204920671-204920693 TGTTCCAGGCTGCGGAGGGAAGG - Exonic
920389261 1:205588846-205588868 GCTTCCAGGGAGCTTACGGCCGG + Intronic
922353046 1:224750478-224750500 GCTTTCAGGGAGAGCAGGGCAGG - Intergenic
922396049 1:225202279-225202301 GCTACCAGGGTGGGTAGGGAAGG + Intronic
922792560 1:228318196-228318218 GGTTCCAGGGTGGGGAGCTCTGG + Intronic
922802912 1:228372209-228372231 CCTCCCTGGATGCGGAGGGCTGG + Exonic
923458762 1:234188601-234188623 GCTACCAGGGTGAGTAGGGAAGG - Intronic
923944221 1:238864673-238864695 GCATCCAGGTTGCTGGGGGCAGG + Intergenic
1062920447 10:1275011-1275033 GCCTGCAGGGTGCGGAGAGTGGG - Intronic
1063907657 10:10797697-10797719 ACTTCCAGGATCCTGAGGGCAGG + Intergenic
1065470964 10:26081152-26081174 GCTACCAGGGTGGGTAGGGAAGG + Intronic
1065546813 10:26829968-26829990 GTTTCCAGGGTCCGGAGGATGGG - Intronic
1066758822 10:38736428-38736450 GGCACCTGGGTGCGGAGGGCTGG + Intergenic
1067565829 10:47336085-47336107 GCTGTCAGGGCGCGGAGGGAGGG + Intergenic
1067850365 10:49750485-49750507 TCTTCCAGGGAAGGGAGGGCAGG - Intronic
1068956010 10:62818924-62818946 GCCAGCAGGGCGCGGAGGGCAGG + Intronic
1069150501 10:64953825-64953847 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
1069571216 10:69495439-69495461 GCATCCAGGGTGGGGAGTGGAGG + Intronic
1070162369 10:73874104-73874126 GCCTGAAGGGTGCGGAGGGGCGG + Intronic
1072948791 10:99834767-99834789 GCTTCCAGGGAGTGAAGGGTGGG - Intronic
1073457682 10:103647412-103647434 GAGACCAGGGTGTGGAGGGCAGG + Intronic
1075088548 10:119430144-119430166 GCTTGCAGGGGGCTGGGGGCTGG + Intronic
1075660604 10:124193171-124193193 GCTACCAGGGTGAGTAGGGAAGG + Intergenic
1075999689 10:126905214-126905236 GGTGCCCGGGTGCGGAGCGCGGG + Intergenic
1076677782 10:132156388-132156410 GCTGCCCGGGTGGAGAGGGCTGG + Intronic
1076682568 10:132181400-132181422 ACTTCCAGGCTGAGAAGGGCCGG - Intronic
1076722300 10:132397946-132397968 GCTTCCTGGGTGGGGGGCGCAGG + Intronic
1076883443 10:133250903-133250925 GCTTCCAGGGACCGGAGGGTCGG + Intergenic
1076883515 10:133251149-133251171 GCTTCCAGGGACCGGAGGGTCGG - Intergenic
1076888281 10:133272380-133272402 GCGGGCAGGGTGGGGAGGGCTGG - Intronic
1077027636 11:448313-448335 CCCTCCAGGGTGCAGAGGCCGGG - Intronic
1077093304 11:789140-789162 GGTCCCAGGGGGAGGAGGGCGGG + Intronic
1077163979 11:1126894-1126916 GTTTTCAGGGTGCGGGGGGGTGG - Intergenic
1077546224 11:3171219-3171241 GCACCCAGGATGCAGAGGGCAGG - Intergenic
1078561680 11:12377921-12377943 GCTTCCCGGGTACGTCGGGCAGG + Intronic
1079763302 11:24357446-24357468 GCTACCAGGGTGAGTAGGGGGGG + Intergenic
1079791703 11:24747644-24747666 GCTACCAGGGTGCATAGGGAAGG + Intronic
1080387337 11:31817804-31817826 GTTACCTGGGAGCGGAGGGCGGG + Exonic
1080402306 11:31947451-31947473 GCTACCAGGGTGGGTAGGGAAGG - Intronic
1080503585 11:32892568-32892590 CCTTCCGGGCTGCGGAAGGCGGG + Intergenic
1080520295 11:33062679-33062701 GCTGCCAGGGGCCAGAGGGCGGG - Intronic
1080641443 11:34160749-34160771 GGTCCCTGGGTGCTGAGGGCAGG + Intronic
1080779941 11:35420095-35420117 GCTCCCTGGGGGCGGCGGGCGGG + Intergenic
1082812097 11:57484593-57484615 CCTTCCAGGGCCAGGAGGGCAGG - Exonic
1083226325 11:61287207-61287229 GATTCCATGCTGCTGAGGGCAGG - Intronic
1084302591 11:68261233-68261255 ACCTCCAGGGTGCGGAGTGATGG + Intergenic
1084564725 11:69922358-69922380 GCTTCCAGGCTGCAGCAGGCAGG + Intergenic
1084691922 11:70732565-70732587 GCTTCTAGGGAGGGGAGGGTCGG - Intronic
1085347564 11:75778111-75778133 GCTTCCTGGGTGAGGTGGGTGGG - Intronic
1087253002 11:95924232-95924254 GCTCCCAGGGTGAGGGGGTCTGG + Exonic
1089664924 11:120012380-120012402 GCTTCCAAGGCTCAGAGGGCTGG - Intergenic
1090265797 11:125352077-125352099 GCTTCCAGGAGGAGAAGGGCAGG - Intronic
1090709776 11:129374397-129374419 GCTTCCCGGGCGCGGAGGCTCGG + Intergenic
1090728989 11:129553540-129553562 GGTTCCACTGTGGGGAGGGCAGG + Intergenic
1090753044 11:129764048-129764070 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
1091210515 11:133854397-133854419 GCTACCAGGGTGCGTAGGGAAGG + Intergenic
1091548317 12:1519050-1519072 GCTCCCAGAGGGCGGAGGACGGG - Intergenic
1091933662 12:4417505-4417527 GCATCCAGGGTGCAGGGGCCAGG + Intergenic
1093409255 12:18845179-18845201 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
1093488716 12:19681267-19681289 GCTACCAGGGTGGGTAGGGAAGG + Intronic
1095665201 12:44789053-44789075 GCTACCAGGGTGAGTAGGGAAGG - Intronic
1096537864 12:52286965-52286987 ACTTCCGGTGTGGGGAGGGCTGG - Intronic
1096563303 12:52452214-52452236 GCTTGCAGGTTGGGAAGGGCTGG + Intergenic
1096565455 12:52473877-52473899 GCTTGCAGGTTGGGAAGGGCTGG + Intergenic
1096567474 12:52493325-52493347 GCTTGCAGGTTGGGAAGGGCTGG + Intergenic
1096749825 12:53751673-53751695 GCCTGCAGGGTGCGGAGCGGGGG + Intergenic
1097218274 12:57430850-57430872 GCTTCCCCGGGGCCGAGGGCTGG + Exonic
1097261161 12:57720971-57720993 GGTTCCAGGGTGGGGAGGTGGGG - Exonic
1097761758 12:63474279-63474301 GATTCCAGAGGGGGGAGGGCTGG - Intergenic
1100542829 12:95574077-95574099 GCTGCCGGGGAGGGGAGGGCTGG + Intergenic
1100706340 12:97203912-97203934 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
1101290398 12:103361908-103361930 GCTACCAGGGTGGGTAGGGAAGG - Intronic
1101446619 12:104741354-104741376 GCTTCCAGTGAGAGGAAGGCTGG - Intronic
1101635257 12:106535391-106535413 GCTACCAGGGTGGGTAGGGAAGG + Intronic
1101679968 12:106955632-106955654 GCGTCCAGGGGGCGAAGGGGCGG + Intergenic
1102456985 12:113077178-113077200 GCAGCCAGGGTGAGGGGGGCCGG - Intronic
1102635720 12:114321843-114321865 CATTCCAGGGTGGGGAGGACAGG - Intergenic
1103611511 12:122127044-122127066 ACTGTCAGGGCGCGGAGGGCAGG - Intronic
1104369278 12:128208698-128208720 GCTTCCAGGGTTCTGAGTGTGGG - Intergenic
1104730597 12:131103422-131103444 GATTCCTGGGTGCGTGGGGCTGG - Intronic
1104759096 12:131286469-131286491 GCTTCCTGGGAGAGGCGGGCAGG + Intergenic
1104821514 12:131680027-131680049 GCTTCCTGGGAGAGGCGGGCAGG - Intergenic
1105314463 13:19244370-19244392 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
1107536932 13:41344523-41344545 GCATCCAGTGTGTGGAGGCCAGG + Intronic
1109284701 13:60397123-60397145 GCTCCCAGGCTGCGGAGCTCCGG - Intronic
1109560764 13:64047220-64047242 GCTACCAGGGTGGGGAGGGGAGG - Intergenic
1112331627 13:98481421-98481443 GCTCCCAGGGTGTGGAGGTGGGG - Intronic
1113582686 13:111440116-111440138 GCCTCTTGGGTGCAGAGGGCAGG + Intergenic
1113857601 13:113456630-113456652 GCTGCCGAGGTGTGGAGGGCTGG - Intronic
1115143022 14:30196022-30196044 GCTTCCAGGTCACAGAGGGCTGG - Intergenic
1115969827 14:38932680-38932702 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
1116330923 14:43596891-43596913 GCCTCCAGGGTACAGAGAGCTGG + Intergenic
1118162340 14:63302479-63302501 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
1118740594 14:68736902-68736924 GCTTCCAGGCTGCTCGGGGCTGG - Intergenic
1121379575 14:93451419-93451441 GCTGCCAGGGGTTGGAGGGCAGG + Intronic
1121914505 14:97824455-97824477 GCTTTCAGGGTGAGGTTGGCAGG - Intergenic
1121949347 14:98156798-98156820 ACTTCCACAGTGCGGGGGGCAGG + Intergenic
1122165850 14:99823130-99823152 GGTTCCAGGGTGGGGTGGGACGG + Intronic
1122314287 14:100816569-100816591 ACTTCCTGGGTGCCTAGGGCTGG - Intergenic
1122838545 14:104443285-104443307 GGGTCCAGAGTGGGGAGGGCCGG - Intergenic
1122884141 14:104703083-104703105 GCTGCCAGGGTGGAGTGGGCAGG - Exonic
1122987012 14:105217174-105217196 GCAGCCAGGGTGCGCAGAGCAGG + Intronic
1124044742 15:26138421-26138443 GCATCCAGAGTGTGGAGGCCAGG + Intergenic
1124149859 15:27167807-27167829 GCTGCCAGGGTCCGTAGGGAAGG + Intronic
1125678320 15:41514093-41514115 GCTTCCAGGTTCCTGAGGACAGG + Intergenic
1126139348 15:45424589-45424611 GCTGCCAGGGTCTGAAGGGCTGG + Intergenic
1126460776 15:48913183-48913205 GCTACCAGGGTGGGTAGGGAAGG + Intronic
1127008200 15:54594414-54594436 GCTACCAGGGTGGGTAGGGAAGG + Intronic
1127421519 15:58811004-58811026 GCTTCCAGGGAGGGAAGGGTAGG - Intronic
1127866584 15:63038156-63038178 GCTTCCTGGGGGCGGGGGGTGGG - Intergenic
1129680981 15:77658165-77658187 GACTCCAGGGTGGGCAGGGCAGG - Intronic
1129983613 15:79897012-79897034 GCGCCCAGGGCGCCGAGGGCGGG - Exonic
1130274577 15:82469727-82469749 CGTTCCTGGGTGCGGGGGGCTGG + Intergenic
1130589220 15:85201694-85201716 CGTTCCTGGGTGCGGGGGGCTGG + Intergenic
1131360806 15:91789019-91789041 GCTGCCAGGGTGTGGACAGCAGG - Intergenic
1131671769 15:94627358-94627380 TCTTCAAGGGTGGGGTGGGCTGG + Intergenic
1132357032 15:101179461-101179483 GCTTCCAGGGAGCTAAGGGAAGG + Intronic
1132500617 16:283144-283166 GCTGCCAGGGCGCGTGGGGCGGG - Exonic
1132655023 16:1038208-1038230 CCTTCCAGGGAGCAGAGGGCTGG - Intergenic
1132974983 16:2706656-2706678 GATTGGAGGGTGGGGAGGGCAGG + Intronic
1133589362 16:7227740-7227762 GATTCCAGGGTGCCTAGGCCAGG - Intronic
1133931909 16:10239595-10239617 GCCTCCAGCCTGCGGATGGCCGG - Intergenic
1134537080 16:15034719-15034741 GCCGCCAGGGTGCGGTGGGGAGG - Intronic
1135303370 16:21349565-21349587 GCTTCCAGGGTGCACATAGCAGG + Intergenic
1135735840 16:24931216-24931238 GCTGGGAGGGGGCGGAGGGCTGG + Exonic
1136842317 16:33548825-33548847 GGCACCTGGGTGCGGAGGGCTGG - Intergenic
1137389084 16:48066624-48066646 GCTTCCAGGAAGAGGAGGCCTGG + Intergenic
1137783821 16:51120988-51121010 GCATCCAGTGGGCAGAGGGCAGG - Intergenic
1137792298 16:51185348-51185370 GCTTCCACGGGGTGGAGAGCTGG + Intergenic
1138287691 16:55822625-55822647 GCTTCAAAGGTGAGGTGGGCTGG + Intronic
1139402678 16:66695561-66695583 GCTTCCAGGGTGTTCTGGGCAGG - Intronic
1140789436 16:78376669-78376691 GCATCCAGGGGGCAGAGGTCAGG - Intronic
1141662065 16:85446772-85446794 GCTTCCTGGGTGCGTTGGGCAGG + Intergenic
1141985592 16:87577603-87577625 GGTGCCAGGGTGTGGAGGACAGG - Intergenic
1142061849 16:88035529-88035551 GCTTCCAGGGTGCACATAGCGGG + Intronic
1142245847 16:88969725-88969747 GCTGCCAGGGTGCGAGTGGCAGG + Intronic
1142253034 16:89001497-89001519 GCTCCCAGGGTGCTGAGCCCAGG - Intergenic
1142273927 16:89105792-89105814 TCTCCCAGGGAGCTGAGGGCAGG + Intronic
1142420408 16:89966326-89966348 GCTTCCAGGGTGGCCAGGACGGG - Exonic
1203152482 16_KI270728v1_random:1849122-1849144 GGCACCTGGGTGCGGAGGGCTGG - Intergenic
1143030280 17:3963882-3963904 GCTTCCAGGGTGGACGGGGCCGG + Intronic
1143984068 17:10895946-10895968 GCTGCCAGGGTGCTGGGGGTAGG + Intergenic
1144139664 17:12336477-12336499 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
1144411999 17:15010573-15010595 GACTCCAGGTGGCGGAGGGCAGG + Intergenic
1144844409 17:18208895-18208917 GCTTGCAGGGCGTGGATGGCAGG - Exonic
1145747872 17:27333247-27333269 GCCTCCAGGGAGCGGAGCTCTGG - Intergenic
1146208132 17:30922192-30922214 GGGTCCAGGGGGCCGAGGGCGGG - Intronic
1147248840 17:39140366-39140388 GCTTGCAGGGAGCGGAGCTCGGG - Intronic
1147581381 17:41629088-41629110 GCTGCAAGGATGCCGAGGGCTGG - Intergenic
1148000750 17:44385698-44385720 GCTGCCAGGGGGCGCAGGCCTGG + Exonic
1148525164 17:48325184-48325206 GCTTGCAGTGAGCGGAGAGCAGG + Intronic
1148700016 17:49581617-49581639 GCCTCCAGGGTGGGGAGCGGAGG - Intronic
1148965035 17:51427907-51427929 GTTTCCAGGGTGGTGGGGGCAGG + Intergenic
1150540804 17:66096991-66097013 GCTTACAGGGTTTGGAGGGCTGG - Intronic
1152002652 17:77656075-77656097 TCATCCAGGGTGCAGAGTGCAGG - Intergenic
1152048961 17:77958290-77958312 GCGCCCAGGGACCGGAGGGCAGG + Intergenic
1152288375 17:79425188-79425210 GTTTGCAGGGTGCGGTGGCCTGG - Intronic
1153810092 18:8744854-8744876 ACTTCCGGGGGGTGGAGGGCAGG - Intronic
1154399299 18:14020103-14020125 GCTTCCATGGTGGGGAGGGGGGG + Intergenic
1154450804 18:14474068-14474090 GAGTCCAGGGTGTGGAGGGGTGG - Intergenic
1156011361 18:32501268-32501290 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
1156453627 18:37280594-37280616 GCTTCCAGGAGGAGGTGGGCTGG + Intronic
1157320188 18:46628366-46628388 GACTCCAGGGTAGGGAGGGCTGG - Intronic
1157706930 18:49814490-49814512 GATACCAGGGCTCGGAGGGCCGG + Intronic
1158649680 18:59273879-59273901 GCTTCCAGGGGGCACAGGCCAGG - Intronic
1159906568 18:74097663-74097685 GCTACCAGGGTGGGCAGGGAAGG - Intronic
1160021362 18:75184284-75184306 GCTTACAGGGCGGGGAGTGCAGG - Intergenic
1160219748 18:76965973-76965995 GCTTCCAGGGTGGGTAGAGAAGG + Intronic
1160330999 18:77991626-77991648 GCCTCCAGGGTGGGGTGTGCTGG + Intergenic
1160503250 18:79412538-79412560 GCCTGCAGGGTGAGGAAGGCAGG + Intronic
1160535588 18:79589802-79589824 ACATGCAGGGTGGGGAGGGCAGG - Intergenic
1160673864 19:378309-378331 GCTGCCTGGGTGCTGAGAGCCGG - Intergenic
1160969790 19:1762493-1762515 GCTTCCCGGGTGCTGCGGGACGG - Intronic
1161027074 19:2041737-2041759 ACTTAGAGGGTGCGCAGGGCAGG + Intronic
1161718898 19:5892544-5892566 ACTTCCCGGCTGCGGTGGGCAGG + Exonic
1162319095 19:9960240-9960262 CTTTCCAGGGTGCTGGGGGCTGG - Exonic
1164733711 19:30525238-30525260 GATTGCAGGGTGAGGAGGCCTGG - Intronic
1165383374 19:35496071-35496093 GTTTCCAGGATGCAGAGGGAGGG - Intergenic
1165453052 19:35896310-35896332 GCTTCCAGGGCCAGGAGGCCAGG - Intronic
1166422969 19:42652826-42652848 CCTCCTAGGGTGCAGAGGGCAGG - Intronic
1166448870 19:42880933-42880955 GCCCCCAGGGTGCAGCGGGCAGG + Intronic
1166604239 19:44126628-44126650 GCTACCAGGGTGGGTAGGGAAGG + Intronic
1166742613 19:45123386-45123408 GTTTCCAGGATGTGGAGAGCGGG - Intronic
1167494495 19:49809571-49809593 GCTTCCTGGGTACGGGAGGCAGG + Exonic
1168458392 19:56533703-56533725 GCTACCAGGGTGGGCAGGGAAGG + Intergenic
1168468211 19:56620953-56620975 GCTTGCAGGGAGCAAAGGGCAGG - Intronic
925650399 2:6083390-6083412 GTTACCAGGGTGAGGAGGGGAGG - Intergenic
925959637 2:9003399-9003421 CCTTCCAGGGAGCGGCGGGTAGG + Intronic
926207720 2:10845935-10845957 GCTCCCAGGGTGTGCAGGGCAGG - Intergenic
927455702 2:23247501-23247523 GCTTCCAGGGAGGGCTGGGCAGG + Intergenic
927811008 2:26180103-26180125 GGTCCCAGGGCGGGGAGGGCAGG + Intronic
928772521 2:34719563-34719585 GCTACCAGGGTGAGTAGGGAAGG + Intergenic
929581143 2:43082431-43082453 GCTGCCAGGGTGAGGTGGGTCGG + Intergenic
929601248 2:43206158-43206180 GTTTCCAGGGACAGGAGGGCTGG + Intergenic
929806028 2:45145592-45145614 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
930130515 2:47845143-47845165 GATTCCAGGGTGGGGTGGGTGGG - Intronic
930486494 2:52017723-52017745 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
931665841 2:64609208-64609230 GATGCCAGGATGCGGGGGGCCGG + Intergenic
932728339 2:74198929-74198951 GCTTCCTCGGCGCGGAGGGCTGG + Intronic
932954621 2:76337233-76337255 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
934275176 2:91568513-91568535 GGCACCTGGGTGCGGAGGGCTGG - Intergenic
934322152 2:91980773-91980795 GGCACCTGGGTGCGGAGGGCTGG + Intergenic
934460438 2:94211559-94211581 GGCACCTGGGTGCGGAGGGCTGG + Intergenic
936008702 2:108911132-108911154 GCTTCCAGGGGCCGGAGTCCTGG - Intronic
936833784 2:116682019-116682041 GCTGTCAGGGGGTGGAGGGCTGG + Intergenic
937451259 2:122003491-122003513 GCTGCCAGGGTGTGGAGGGCAGG + Intergenic
937828927 2:126399290-126399312 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
938038065 2:128053112-128053134 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
938199495 2:129361678-129361700 GCTTCCTGGGTGGGAGGGGCTGG - Intergenic
938313939 2:130313824-130313846 GGGTCCAGGGTGCAGAGGCCTGG + Intergenic
940172351 2:150842956-150842978 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
940709371 2:157143907-157143929 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
941627451 2:167845146-167845168 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
942919764 2:181358178-181358200 GCTGCCAGGGGGCTGAGGGTGGG - Intergenic
943891225 2:193289811-193289833 GCTACCAGGGTGGGTAGGGATGG + Intergenic
943938614 2:193959946-193959968 GCTTGCAGGGAGCGGAGGTCGGG + Intergenic
944228751 2:197372695-197372717 TCATCCAGGGTGTGGAGGGAGGG + Intergenic
944716138 2:202377091-202377113 ATATCCAGGGTGCGGAGGGCGGG - Exonic
946015857 2:216603261-216603283 GCTTCCAGGGAGAGAAAGGCTGG + Intergenic
946242767 2:218367161-218367183 CCTTCCAGGATGCAGGGGGCTGG + Intronic
946725334 2:222656359-222656381 GCTTCCAGGGCGCTAACGGCCGG + Intergenic
947950586 2:234143626-234143648 TCTTCCAGGATGCGGAGGGGTGG - Intergenic
948220159 2:236262925-236262947 GCTTGCAGGGTGCTGAGGCGAGG - Intronic
1169401336 20:5283041-5283063 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
1170574380 20:17651649-17651671 GCTTCCCGGGGGTGGAGGGGCGG - Intronic
1170863140 20:20127777-20127799 GCTACCAGGGTGGGTAGGGAAGG + Intronic
1172152488 20:32800348-32800370 GGTTTCAGGGTGTGGAGGACTGG - Intronic
1172658061 20:36548994-36549016 GCTGCCAGGGGGCTGAGGGATGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174178026 20:48657236-48657258 GCTTCCTTGGTGAGGAGGGAAGG - Intronic
1175107318 20:56624934-56624956 GTTTCCAAGGGGAGGAGGGCAGG + Intergenic
1175216363 20:57393396-57393418 GCTTCCTGGGTCTGGAAGGCTGG + Intronic
1176298687 21:5088329-5088351 GGTGCCAGGGTGAGCAGGGCAGG + Intergenic
1176445429 21:6816506-6816528 GAGTCCAGGGTGTGGAGGGGTGG + Intergenic
1176511201 21:7749644-7749666 TCTTCCAGGCTGCTGACGGCTGG - Intronic
1176823597 21:13681539-13681561 GAGTCCAGGGTGTGGAGGGGTGG + Intergenic
1177195566 21:17900778-17900800 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
1178645315 21:34380173-34380195 TCTTCCAGGCTGCTGACGGCTGG - Intronic
1179086814 21:38225659-38225681 GCTTCCAGGGTGACTAGAGCAGG + Intronic
1179644911 21:42769978-42770000 GCCTCCAGGGTCCTGAAGGCCGG - Intronic
1179786468 21:43733262-43733284 GTTTCCAGGGCGGGGGGGGCGGG - Intronic
1179858339 21:44173620-44173642 GGTGCCAGGGTGAGCAGGGCAGG - Intergenic
1180177622 21:46098184-46098206 GCTTCCAGGGTGCGGGGTCCGGG - Intronic
1180744392 22:18077865-18077887 GCTTCCGGGGCGCGGCGTGCTGG + Intergenic
1180796373 22:18607733-18607755 GCTTCCAGGGTTGTGGGGGCTGG + Exonic
1180833414 22:18918022-18918044 GCCTGCAGGGTGGGGAGGACCGG + Intronic
1181225350 22:21387538-21387560 GCTTCCAGGGTTGTGGGGGCTGG - Exonic
1181253283 22:21547275-21547297 GCTTCCAGGGTTGTGGGGGCTGG + Exonic
1181355808 22:22295196-22295218 GGCACCTGGGTGCGGAGGGCTGG - Intergenic
1181454347 22:23047884-23047906 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
1182134671 22:27890234-27890256 GCTTCCAGGGTTGGGATGGAGGG - Intronic
1183323741 22:37180450-37180472 TCTTCCAGGGTGGGGTGGCCTGG - Exonic
1183343499 22:37294703-37294725 GCTTCGAGAGTGCGGAGGAGAGG + Exonic
1183617512 22:38954501-38954523 GCTTCTAGGCTGAGGAGGGCGGG + Intronic
1183641476 22:39095473-39095495 GCTGTCAGGGTGTGCAGGGCGGG + Intergenic
1183658821 22:39206664-39206686 GCTTCCAGAGGGTGGAGGCCAGG + Intergenic
1183676247 22:39300408-39300430 GCTTCCAGAGAAGGGAGGGCGGG - Intergenic
1184281551 22:43440403-43440425 GAGGCCAGGGTGCTGAGGGCAGG + Intronic
1184773885 22:46613656-46613678 GCCTCCATGGTGCAGAGGGCAGG + Intronic
1184777945 22:46632696-46632718 GATACCAGGGTGGTGAGGGCTGG - Intronic
1185292815 22:50035635-50035657 GCTTCAGGGGCGCGGGGGGCTGG - Intronic
1203283498 22_KI270734v1_random:143320-143342 GCCTGCAGGGTGGGGAGGACCGG + Intergenic
949480617 3:4491368-4491390 GCTGACAGGGAACGGAGGGCAGG + Intergenic
950603537 3:14057709-14057731 GCTACCAGGGTGGGTAGGGAAGG + Intronic
951387268 3:22057842-22057864 GCTTCCAGGGTATGGAGGTCAGG - Intronic
952880259 3:37980928-37980950 GCTCCCAGGGAGCTGAGGACAGG - Exonic
956950281 3:74274206-74274228 GCTACCAGGGTGGGTAGGGAAGG - Intronic
957016380 3:75069391-75069413 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
958013819 3:87914746-87914768 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
958038018 3:88192573-88192595 GCTTCCAGGTTGCAGATGGCAGG - Intergenic
958969926 3:100600557-100600579 GCTACCAGGGTGTGCAGGGAAGG + Intergenic
959263813 3:104113439-104113461 GCTCCCAATGTGGGGAGGGCGGG + Intergenic
959786615 3:110306510-110306532 ATTTCCAGTGTGAGGAGGGCTGG + Intergenic
961538837 3:127586885-127586907 GAGTCCAGGGTATGGAGGGCGGG + Intronic
962066007 3:131981280-131981302 GCTACCAGGGTGGGTAGGGAAGG + Intronic
962098554 3:132317310-132317332 GTTTCCAGGAAGCGTAGGGCAGG - Intergenic
962293649 3:134160004-134160026 GCGTGCAGGGGGCGGGGGGCAGG + Intronic
962583890 3:136821881-136821903 GTTTCCAGGGACTGGAGGGCAGG - Intronic
964160658 3:153641138-153641160 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
964643842 3:158937036-158937058 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
966122428 3:176537113-176537135 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
968010571 3:195271319-195271341 GACTCCAGCGTGCTGAGGGCTGG + Intergenic
968074854 3:195810650-195810672 GCGGCCAGGGCGCAGAGGGCCGG - Intronic
968523167 4:1043605-1043627 GCTTCCTGGGTGCGGTGTGCAGG + Intergenic
968964272 4:3761623-3761645 GCTTGCTGGGTGCTGAGTGCAGG - Intergenic
969149109 4:5153246-5153268 GCTTCCAGATTGGGGAGGTCTGG + Intronic
969184673 4:5466237-5466259 GCTGCCAGGGGGCGGGAGGCGGG + Intronic
969236603 4:5869806-5869828 GGTTCCAGGGTCTGGAGGGAGGG + Intronic
970673465 4:18421705-18421727 GCCTCCAGGTGGCTGAGGGCAGG - Intergenic
970996107 4:22269022-22269044 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
971900981 4:32658094-32658116 GCTGCCAGGGTGGGTAGGGAAGG + Intergenic
972769293 4:42181511-42181533 TCATCCAGGGTGCGGAAGGAAGG + Intergenic
975640595 4:76496201-76496223 GCTTCTGGGGTGAGGAGGGCAGG + Intronic
976246494 4:83010851-83010873 GCCTCCCGGGTGGGGCGGGCGGG - Intronic
976765318 4:88592566-88592588 GCTGCCGAGGTGCGCAGGGCGGG + Exonic
979056111 4:115997233-115997255 GTTTCCAGGGTGTGGGGAGCGGG + Intergenic
980013640 4:127623436-127623458 TCCTCCAGGCTGCGGGGGGCAGG - Intronic
981312168 4:143307857-143307879 GCTTCCTGGGAGGTGAGGGCTGG + Intergenic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
981847079 4:149181822-149181844 GCCTTCAGGGTGTGGGGGGCTGG + Intergenic
982189923 4:152843505-152843527 GCTACCAGGGTGGGTAGGGAGGG + Intronic
984721704 4:182978500-182978522 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
985008611 4:185559848-185559870 GCTACCAGGGTGGGTAGGGAGGG + Intergenic
985092918 4:186382022-186382044 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
985217738 4:187671825-187671847 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
985273716 4:188218428-188218450 GCTCCCAGGGTGTGGAGGTGGGG + Intergenic
985524123 5:393238-393260 GCTGCCAACGTGGGGAGGGCCGG - Intronic
985537682 5:473898-473920 GCTCCCAGGGAGCTGAGAGCAGG - Intronic
985616706 5:927138-927160 GCTTCCAGGGTCCTGGGCGCGGG - Intergenic
985965214 5:3334140-3334162 GCTTCCAGGGTTCCCCGGGCAGG + Intergenic
985989190 5:3541223-3541245 GCTTCCCTGGTGGGGAGGCCAGG - Intergenic
986543700 5:8872998-8873020 GCTTCCAAGGTGGGGAGATCTGG + Intergenic
987297556 5:16567496-16567518 GCAACCAGGGTGCTGAGGCCAGG + Intronic
989727483 5:44603992-44604014 GCTACCAGGGTGGGTAGGGTGGG - Intergenic
991630382 5:68650633-68650655 GCTTCCAGGGTGGAGATGGTGGG - Intergenic
992065633 5:73104996-73105018 GCATCCAGGGAGAGGAGGGCAGG + Intergenic
992776475 5:80093515-80093537 ACTTCCAGGGAGCAGGGGGCAGG + Intergenic
993743024 5:91563181-91563203 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
994051290 5:95365564-95365586 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
995317890 5:110797245-110797267 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
996010770 5:118479246-118479268 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
997765712 5:136501344-136501366 GCTACCAGGGTGTGTAGGGAAGG + Intergenic
998207170 5:140166152-140166174 CCTTCCAGGCTGGGGAGGGGAGG + Intergenic
1000052546 5:157575458-157575480 GCTCCCAGGCTGGGGACGGCGGG + Intronic
1001333215 5:170777005-170777027 GCTTCCAGGGAGGGGCGGCCTGG - Intronic
1002313374 5:178328110-178328132 CCTGCCTGGGTGCGGAGGGCAGG + Intronic
1002384998 5:178860075-178860097 GCTTGCAGAGTGCGGCGGGGAGG + Exonic
1002522218 5:179798217-179798239 GCTTCCAGAGGGCCGAAGGCTGG + Exonic
1002566405 5:180114649-180114671 GACCCCAGGGTGCAGAGGGCAGG + Intronic
1002788876 6:424298-424320 GCTTCCTCGGCGGGGAGGGCGGG - Intergenic
1003004148 6:2365266-2365288 GCTGTCAGGGAGCGGGGGGCAGG - Intergenic
1003113445 6:3267289-3267311 GCTTTCTGGGTCAGGAGGGCTGG + Intronic
1003163988 6:3660491-3660513 GCTTCCAAGGTGCGAGGGACGGG + Intergenic
1004865052 6:19845301-19845323 GTTTCCGGGGTGAGGAGGGGAGG - Intergenic
1005971957 6:30768766-30768788 GCTACCAGGGTGCAGAGGCAGGG - Intergenic
1006431866 6:34002114-34002136 GCTTCCAGAGTGGGGCGGGCTGG + Intergenic
1006891533 6:37433337-37433359 GCTGCCGGGGAGCGGAGGGGGGG - Exonic
1006984766 6:38169137-38169159 GCTTCCAGGGTCAGCAGGGCAGG - Exonic
1007573744 6:42911543-42911565 GCTTCCAGGCTGCGGTGGCCAGG + Intergenic
1007743734 6:44029490-44029512 GGTTCTAGGGAGGGGAGGGCAGG + Intergenic
1010008941 6:71028135-71028157 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
1010727569 6:79352766-79352788 CCTGTCAGGGTGCGGGGGGCTGG + Intergenic
1011495534 6:87933601-87933623 GCATCCAGGATGTGGAGGGCTGG + Intergenic
1011620399 6:89237326-89237348 GCTTCCAGGGTGGGGAGGGAAGG + Intergenic
1011657706 6:89566534-89566556 TCTCCCAGGGAGCGGAGGCCTGG - Intronic
1011817807 6:91213409-91213431 GCTACCAGGGTGAGTAGGGAAGG + Intergenic
1012594459 6:101023661-101023683 GCTTCCAGGGTCCTAAGGACAGG + Intergenic
1013174941 6:107668956-107668978 GCTTCCAGGGAGCAGAAGGAGGG + Intergenic
1013321663 6:108997021-108997043 GTTTCCAGGGTTGGGAGGGAGGG + Intronic
1014304807 6:119727408-119727430 GCTTCCAGGGTGGGTAGGGAAGG + Intergenic
1015362347 6:132354742-132354764 GCTACCAGGGTGGGTAGGGAAGG + Intronic
1015853779 6:137602502-137602524 GCCTCCAGGGTATGGGGGGCGGG + Intergenic
1018114929 6:160573985-160574007 GCTACCAGGGTGGGTAGGGAAGG + Intronic
1018400090 6:163413857-163413879 TCGCCCACGGTGCGGAGGGCTGG - Intergenic
1019356585 7:583047-583069 GCTGCCAGGGCCGGGAGGGCAGG + Intronic
1019523101 7:1469312-1469334 TCTTCCAGGCTGCACAGGGCCGG - Intergenic
1019659641 7:2216959-2216981 GCTCCCAGTACGCGGAGGGCTGG - Intronic
1019912153 7:4107106-4107128 ACATCCAGGGTGGGGAGGGTGGG + Intronic
1020358566 7:7303471-7303493 GCTACCAGGGTGTGTAGGGAAGG + Intergenic
1021292268 7:18860888-18860910 GCTACAAGGGTGTGGAGAGCGGG - Intronic
1022547140 7:31200153-31200175 GCTTCCCTGGTGTGGAGGGTTGG + Intergenic
1023382548 7:39623425-39623447 GCTTGCAGGGGGCGGAGGCCGGG + Intergenic
1023481183 7:40636358-40636380 GCTTCCAGGGAGAGGTGGGGAGG + Intronic
1023881943 7:44325684-44325706 GCGTGCAGGGGGCGGCGGGCGGG - Intronic
1024257058 7:47547144-47547166 CCCTCCAGGGTGAGGAGGGAGGG + Intronic
1024476844 7:49821001-49821023 GCATCCTGGGCGGGGAGGGCTGG - Intronic
1024639292 7:51316626-51316648 GCGTCCATGGTGCCGGGGGCCGG + Exonic
1024745347 7:52399877-52399899 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
1025807533 7:64849529-64849551 GCTACCAGGGTGGGTAGGGAGGG + Intergenic
1026902268 7:74043799-74043821 GCTGCCTGGGTGGGAAGGGCTGG + Intronic
1026941789 7:74291283-74291305 GCCTGCACGGTGCTGAGGGCTGG - Intronic
1027295388 7:76764288-76764310 GCTACCAGGGTGGGGAGGGGAGG - Intergenic
1027350439 7:77306275-77306297 GCTACCAGGGTGGGTAGGGAAGG + Intronic
1028182947 7:87747571-87747593 GCTGCCAGGGTGGGTAGGGAAGG + Intronic
1028254722 7:88579970-88579992 GCTTCCAGGCTGAGAAGGGATGG - Intergenic
1029179280 7:98688270-98688292 GCTTCCAGGAGGAGGTGGGCTGG + Intergenic
1029895469 7:103978887-103978909 GCCTCCAGGGTGGGGAGGGTAGG - Intronic
1031300241 7:120055522-120055544 GCTTCCAGGGTGACTAGAGCAGG + Intergenic
1031612737 7:123846234-123846256 GCTGCCAGGGTGGGTAGGGAAGG + Intronic
1034489818 7:151387240-151387262 GCTTCCTGGGTGACCAGGGCAGG + Intronic
1037833138 8:22200927-22200949 GCATCCAGGGCACGGAGGGCTGG - Intronic
1038349359 8:26762373-26762395 GCTTCCAGAGAGCCCAGGGCAGG - Intronic
1039467872 8:37796984-37797006 GCCTCCAGTGTCCCGAGGGCCGG + Intronic
1039571841 8:38593106-38593128 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
1039979188 8:42392041-42392063 GCTACCGGGGCGCGGGGGGCCGG + Intronic
1040550287 8:48432191-48432213 GCTTCCTGGAGGAGGAGGGCAGG + Intergenic
1040635656 8:49270380-49270402 GCTGCCAGGGTGGGTAGGGAAGG + Intergenic
1040866341 8:52052305-52052327 ACTACCAGGGTGGGGAGGGAAGG - Intergenic
1041483645 8:58350100-58350122 GTTTCCAGGGTCTGGAGGGAGGG - Intergenic
1041877969 8:62712325-62712347 GCTACCAGGGTGGGTAGGGAAGG + Intronic
1043443415 8:80297137-80297159 GAGGCCAGGGTGCGGAGTGCGGG - Intergenic
1043816865 8:84812518-84812540 GCTACCAGGGTGAGTAGGGCAGG + Intronic
1048904494 8:139074812-139074834 GCTTCCAGGGGGTGGTGTGCTGG - Intergenic
1049218884 8:141419966-141419988 CCACCCAGGGTGTGGAGGGCAGG + Intronic
1049292556 8:141812386-141812408 GCCTCCAGGGCGGGGAGGGCGGG + Intergenic
1049473052 8:142784735-142784757 CCTTCCAGGGTGGGGACGGACGG + Intergenic
1049653302 8:143786710-143786732 GCTACCAGGGCGGGCAGGGCTGG + Intergenic
1049686903 8:143942705-143942727 GCTTCCTGGCTGCGCTGGGCGGG - Intronic
1049869763 8:144965558-144965580 GCTACCAGGGTGGGTAGGGAAGG + Intergenic
1052762607 9:32608174-32608196 GCTTGCAGGGTGGGGAGTGAGGG - Intergenic
1053139882 9:35675850-35675872 AGTTCCAGGGGGCGCAGGGCCGG - Exonic
1053690935 9:40587256-40587278 GGCACCTGGGTGCGGAGGGCTGG + Intergenic
1054273869 9:63050235-63050257 GGCACCTGGGTGCGGAGGGCTGG - Intergenic
1054302195 9:63388227-63388249 GGCACCTGGGTGCGGAGGGCTGG + Intergenic
1054400971 9:64714733-64714755 GGCACCTGGGTGCGGAGGGCTGG + Intergenic
1055125989 9:72718794-72718816 GCTACCAGGGTGGGTAGGGAAGG + Intronic
1055414965 9:76071854-76071876 GCTTGCCGGGTGAGGGGGGCTGG - Exonic
1055638075 9:78297196-78297218 GCGTCCATGGTGCGGCGGCCAGG - Exonic
1055654258 9:78437612-78437634 GCATCCAGGATGCAGAGGCCAGG - Intergenic
1056932327 9:90889535-90889557 ACTCCCAGGGTGGGGAGGGGAGG - Intronic
1057051849 9:91929820-91929842 GCTTCCTGGGTGCTAAGGCCAGG + Intronic
1057724234 9:97556879-97556901 GGTTCCGGGCTGGGGAGGGCAGG + Intronic
1059409834 9:114124893-114124915 GCCTCCAGAGTGGGGAGGGCAGG - Intergenic
1060217425 9:121746688-121746710 GCTTCCTGGATGTGGAGAGCTGG + Intronic
1060915267 9:127385137-127385159 GCCTCCAGGGTGAGTAGGACTGG + Exonic
1061429269 9:130520951-130520973 GCTTCCAGGGGCGGGAGGGGTGG + Intergenic
1062049442 9:134439473-134439495 GCTTCCAGGGTGCGGAGGGCCGG - Intronic
1062306283 9:135908404-135908426 GCTTCCAGGGAGCGGGCGCCCGG + Intergenic
1062353403 9:136150048-136150070 GCTTCCAGGGTGAGGGTGGCCGG - Intergenic
1062572482 9:137191976-137191998 GCTTCCAGGGCCAGGAGGGGTGG + Exonic
1203523766 Un_GL000213v1:68019-68041 GAGTCCAGGGTGTGGAGGGGTGG - Intergenic
1185493494 X:537100-537122 CGTCCCAGGGTGCAGAGGGCTGG + Intergenic
1185657175 X:1694763-1694785 GCTTCCTCGGGGCTGAGGGCAGG - Intergenic
1185880428 X:3735308-3735330 GCCTTCACGGAGCGGAGGGCTGG + Intergenic
1186430788 X:9502800-9502822 GCATCCAGAGGGCAGAGGGCAGG - Intronic
1187716351 X:22106321-22106343 GCTTCCAGCTTGCAGAGGTCTGG + Intronic
1189358835 X:40332603-40332625 GCTTCAAGGGGATGGAGGGCAGG + Intergenic
1189603197 X:42648883-42648905 GCTACCAGGGTGGGTAGGGAAGG - Intergenic
1189879167 X:45471300-45471322 ACTTCCAGGGTGGGTAGGGAAGG + Intergenic
1192881090 X:75284887-75284909 GCTACCAGGGTGAGTAGGGAAGG + Intronic
1195210877 X:102651665-102651687 GCTGTCAGGGTCCGGGGGGCAGG - Exonic
1196313071 X:114190932-114190954 GCTACCAGGGTGGGGTGGGAGGG + Intergenic
1197705962 X:129634608-129634630 TCTCCCAGAGTGTGGAGGGCGGG + Intergenic
1199913738 X:152315901-152315923 GCTACCAGGGTGGGAAGGGAAGG - Intronic
1201709803 Y:16978243-16978265 GCTTCCAGTGTGTAGAGGGCAGG - Intergenic