ID: 1062049957

View in Genome Browser
Species Human (GRCh38)
Location 9:134442163-134442185
Sequence CTGGAAAAGGGGTCGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062049948_1062049957 -10 Left 1062049948 9:134442150-134442172 CCCCTTCCGTGGTCTGGAAAAGG No data
Right 1062049957 9:134442163-134442185 CTGGAAAAGGGGTCGGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062049957 Original CRISPR CTGGAAAAGGGGTCGGCCCT GGG Intergenic
No off target data available for this crispr