ID: 1062049982

View in Genome Browser
Species Human (GRCh38)
Location 9:134442302-134442324
Sequence CAGAGTCCAGGGGGCCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062049982_1062049992 7 Left 1062049982 9:134442302-134442324 CCCTGGTGGCCCCCTGGACTCTG No data
Right 1062049992 9:134442332-134442354 CCTCCACGGACACCCGTCCTTGG No data
1062049982_1062049993 8 Left 1062049982 9:134442302-134442324 CCCTGGTGGCCCCCTGGACTCTG No data
Right 1062049993 9:134442333-134442355 CTCCACGGACACCCGTCCTTGGG No data
1062049982_1062049999 26 Left 1062049982 9:134442302-134442324 CCCTGGTGGCCCCCTGGACTCTG No data
Right 1062049999 9:134442351-134442373 TTGGGGTGAGAGTGAGCCCTCGG No data
1062049982_1062049990 -7 Left 1062049982 9:134442302-134442324 CCCTGGTGGCCCCCTGGACTCTG No data
Right 1062049990 9:134442318-134442340 GACTCTGGGCACAGCCTCCACGG No data
1062049982_1062049994 9 Left 1062049982 9:134442302-134442324 CCCTGGTGGCCCCCTGGACTCTG No data
Right 1062049994 9:134442334-134442356 TCCACGGACACCCGTCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062049982 Original CRISPR CAGAGTCCAGGGGGCCACCA GGG (reversed) Intergenic