ID: 1062049988

View in Genome Browser
Species Human (GRCh38)
Location 9:134442313-134442335
Sequence GAGGCTGTGCCCAGAGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062049988_1062049994 -2 Left 1062049988 9:134442313-134442335 CCCTGGACTCTGGGCACAGCCTC No data
Right 1062049994 9:134442334-134442356 TCCACGGACACCCGTCCTTGGGG No data
1062049988_1062049993 -3 Left 1062049988 9:134442313-134442335 CCCTGGACTCTGGGCACAGCCTC No data
Right 1062049993 9:134442333-134442355 CTCCACGGACACCCGTCCTTGGG No data
1062049988_1062050000 25 Left 1062049988 9:134442313-134442335 CCCTGGACTCTGGGCACAGCCTC No data
Right 1062050000 9:134442361-134442383 AGTGAGCCCTCGGAGTTCTCAGG No data
1062049988_1062049992 -4 Left 1062049988 9:134442313-134442335 CCCTGGACTCTGGGCACAGCCTC No data
Right 1062049992 9:134442332-134442354 CCTCCACGGACACCCGTCCTTGG No data
1062049988_1062049999 15 Left 1062049988 9:134442313-134442335 CCCTGGACTCTGGGCACAGCCTC No data
Right 1062049999 9:134442351-134442373 TTGGGGTGAGAGTGAGCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062049988 Original CRISPR GAGGCTGTGCCCAGAGTCCA GGG (reversed) Intergenic