ID: 1062049990

View in Genome Browser
Species Human (GRCh38)
Location 9:134442318-134442340
Sequence GACTCTGGGCACAGCCTCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062049983_1062049990 -8 Left 1062049983 9:134442303-134442325 CCTGGTGGCCCCCTGGACTCTGG No data
Right 1062049990 9:134442318-134442340 GACTCTGGGCACAGCCTCCACGG No data
1062049978_1062049990 18 Left 1062049978 9:134442277-134442299 CCAGCGGTTGGAAGCTGGCTCTG No data
Right 1062049990 9:134442318-134442340 GACTCTGGGCACAGCCTCCACGG No data
1062049982_1062049990 -7 Left 1062049982 9:134442302-134442324 CCCTGGTGGCCCCCTGGACTCTG No data
Right 1062049990 9:134442318-134442340 GACTCTGGGCACAGCCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062049990 Original CRISPR GACTCTGGGCACAGCCTCCA CGG Intergenic