ID: 1062049994

View in Genome Browser
Species Human (GRCh38)
Location 9:134442334-134442356
Sequence TCCACGGACACCCGTCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062049982_1062049994 9 Left 1062049982 9:134442302-134442324 CCCTGGTGGCCCCCTGGACTCTG No data
Right 1062049994 9:134442334-134442356 TCCACGGACACCCGTCCTTGGGG No data
1062049983_1062049994 8 Left 1062049983 9:134442303-134442325 CCTGGTGGCCCCCTGGACTCTGG No data
Right 1062049994 9:134442334-134442356 TCCACGGACACCCGTCCTTGGGG No data
1062049987_1062049994 -1 Left 1062049987 9:134442312-134442334 CCCCTGGACTCTGGGCACAGCCT No data
Right 1062049994 9:134442334-134442356 TCCACGGACACCCGTCCTTGGGG No data
1062049986_1062049994 0 Left 1062049986 9:134442311-134442333 CCCCCTGGACTCTGGGCACAGCC No data
Right 1062049994 9:134442334-134442356 TCCACGGACACCCGTCCTTGGGG No data
1062049988_1062049994 -2 Left 1062049988 9:134442313-134442335 CCCTGGACTCTGGGCACAGCCTC No data
Right 1062049994 9:134442334-134442356 TCCACGGACACCCGTCCTTGGGG No data
1062049989_1062049994 -3 Left 1062049989 9:134442314-134442336 CCTGGACTCTGGGCACAGCCTCC No data
Right 1062049994 9:134442334-134442356 TCCACGGACACCCGTCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062049994 Original CRISPR TCCACGGACACCCGTCCTTG GGG Intergenic