ID: 1062049997

View in Genome Browser
Species Human (GRCh38)
Location 9:134442345-134442367
Sequence GCTCACTCTCACCCCAAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062049997_1062050008 16 Left 1062049997 9:134442345-134442367 CCGTCCTTGGGGTGAGAGTGAGC No data
Right 1062050008 9:134442384-134442406 CCAGAGCGCAGGGACAAAAGGGG No data
1062049997_1062050009 26 Left 1062049997 9:134442345-134442367 CCGTCCTTGGGGTGAGAGTGAGC No data
Right 1062050009 9:134442394-134442416 GGGACAAAAGGGGAAAGCTGAGG No data
1062049997_1062050000 -7 Left 1062049997 9:134442345-134442367 CCGTCCTTGGGGTGAGAGTGAGC No data
Right 1062050000 9:134442361-134442383 AGTGAGCCCTCGGAGTTCTCAGG No data
1062049997_1062050004 6 Left 1062049997 9:134442345-134442367 CCGTCCTTGGGGTGAGAGTGAGC No data
Right 1062050004 9:134442374-134442396 AGTTCTCAGGCCAGAGCGCAGGG No data
1062049997_1062050003 5 Left 1062049997 9:134442345-134442367 CCGTCCTTGGGGTGAGAGTGAGC No data
Right 1062050003 9:134442373-134442395 GAGTTCTCAGGCCAGAGCGCAGG No data
1062049997_1062050006 15 Left 1062049997 9:134442345-134442367 CCGTCCTTGGGGTGAGAGTGAGC No data
Right 1062050006 9:134442383-134442405 GCCAGAGCGCAGGGACAAAAGGG No data
1062049997_1062050005 14 Left 1062049997 9:134442345-134442367 CCGTCCTTGGGGTGAGAGTGAGC No data
Right 1062050005 9:134442382-134442404 GGCCAGAGCGCAGGGACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062049997 Original CRISPR GCTCACTCTCACCCCAAGGA CGG (reversed) Intergenic