ID: 1062049998

View in Genome Browser
Species Human (GRCh38)
Location 9:134442349-134442371
Sequence GAGGGCTCACTCTCACCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 221}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062049998_1062050010 29 Left 1062049998 9:134442349-134442371 CCTTGGGGTGAGAGTGAGCCCTC 0: 1
1: 0
2: 0
3: 13
4: 221
Right 1062050010 9:134442401-134442423 AAGGGGAAAGCTGAGGTCTGTGG No data
1062049998_1062050008 12 Left 1062049998 9:134442349-134442371 CCTTGGGGTGAGAGTGAGCCCTC 0: 1
1: 0
2: 0
3: 13
4: 221
Right 1062050008 9:134442384-134442406 CCAGAGCGCAGGGACAAAAGGGG No data
1062049998_1062050009 22 Left 1062049998 9:134442349-134442371 CCTTGGGGTGAGAGTGAGCCCTC 0: 1
1: 0
2: 0
3: 13
4: 221
Right 1062050009 9:134442394-134442416 GGGACAAAAGGGGAAAGCTGAGG No data
1062049998_1062050006 11 Left 1062049998 9:134442349-134442371 CCTTGGGGTGAGAGTGAGCCCTC 0: 1
1: 0
2: 0
3: 13
4: 221
Right 1062050006 9:134442383-134442405 GCCAGAGCGCAGGGACAAAAGGG No data
1062049998_1062050005 10 Left 1062049998 9:134442349-134442371 CCTTGGGGTGAGAGTGAGCCCTC 0: 1
1: 0
2: 0
3: 13
4: 221
Right 1062050005 9:134442382-134442404 GGCCAGAGCGCAGGGACAAAAGG No data
1062049998_1062050003 1 Left 1062049998 9:134442349-134442371 CCTTGGGGTGAGAGTGAGCCCTC 0: 1
1: 0
2: 0
3: 13
4: 221
Right 1062050003 9:134442373-134442395 GAGTTCTCAGGCCAGAGCGCAGG No data
1062049998_1062050004 2 Left 1062049998 9:134442349-134442371 CCTTGGGGTGAGAGTGAGCCCTC 0: 1
1: 0
2: 0
3: 13
4: 221
Right 1062050004 9:134442374-134442396 AGTTCTCAGGCCAGAGCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062049998 Original CRISPR GAGGGCTCACTCTCACCCCA AGG (reversed) Intergenic