ID: 1062050000

View in Genome Browser
Species Human (GRCh38)
Location 9:134442361-134442383
Sequence AGTGAGCCCTCGGAGTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062049989_1062050000 24 Left 1062049989 9:134442314-134442336 CCTGGACTCTGGGCACAGCCTCC No data
Right 1062050000 9:134442361-134442383 AGTGAGCCCTCGGAGTTCTCAGG No data
1062049996_1062050000 -6 Left 1062049996 9:134442344-134442366 CCCGTCCTTGGGGTGAGAGTGAG No data
Right 1062050000 9:134442361-134442383 AGTGAGCCCTCGGAGTTCTCAGG No data
1062049995_1062050000 3 Left 1062049995 9:134442335-134442357 CCACGGACACCCGTCCTTGGGGT No data
Right 1062050000 9:134442361-134442383 AGTGAGCCCTCGGAGTTCTCAGG No data
1062049997_1062050000 -7 Left 1062049997 9:134442345-134442367 CCGTCCTTGGGGTGAGAGTGAGC No data
Right 1062050000 9:134442361-134442383 AGTGAGCCCTCGGAGTTCTCAGG No data
1062049987_1062050000 26 Left 1062049987 9:134442312-134442334 CCCCTGGACTCTGGGCACAGCCT No data
Right 1062050000 9:134442361-134442383 AGTGAGCCCTCGGAGTTCTCAGG No data
1062049988_1062050000 25 Left 1062049988 9:134442313-134442335 CCCTGGACTCTGGGCACAGCCTC No data
Right 1062050000 9:134442361-134442383 AGTGAGCCCTCGGAGTTCTCAGG No data
1062049991_1062050000 6 Left 1062049991 9:134442332-134442354 CCTCCACGGACACCCGTCCTTGG No data
Right 1062050000 9:134442361-134442383 AGTGAGCCCTCGGAGTTCTCAGG No data
1062049986_1062050000 27 Left 1062049986 9:134442311-134442333 CCCCCTGGACTCTGGGCACAGCC No data
Right 1062050000 9:134442361-134442383 AGTGAGCCCTCGGAGTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062050000 Original CRISPR AGTGAGCCCTCGGAGTTCTC AGG Intergenic