ID: 1062050001

View in Genome Browser
Species Human (GRCh38)
Location 9:134442367-134442389
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062050001_1062050008 -6 Left 1062050001 9:134442367-134442389 CCCTCGGAGTTCTCAGGCCAGAG No data
Right 1062050008 9:134442384-134442406 CCAGAGCGCAGGGACAAAAGGGG No data
1062050001_1062050009 4 Left 1062050001 9:134442367-134442389 CCCTCGGAGTTCTCAGGCCAGAG No data
Right 1062050009 9:134442394-134442416 GGGACAAAAGGGGAAAGCTGAGG No data
1062050001_1062050010 11 Left 1062050001 9:134442367-134442389 CCCTCGGAGTTCTCAGGCCAGAG No data
Right 1062050010 9:134442401-134442423 AAGGGGAAAGCTGAGGTCTGTGG No data
1062050001_1062050012 24 Left 1062050001 9:134442367-134442389 CCCTCGGAGTTCTCAGGCCAGAG No data
Right 1062050012 9:134442414-134442436 AGGTCTGTGGTTGCAGGACACGG No data
1062050001_1062050006 -7 Left 1062050001 9:134442367-134442389 CCCTCGGAGTTCTCAGGCCAGAG No data
Right 1062050006 9:134442383-134442405 GCCAGAGCGCAGGGACAAAAGGG No data
1062050001_1062050005 -8 Left 1062050001 9:134442367-134442389 CCCTCGGAGTTCTCAGGCCAGAG No data
Right 1062050005 9:134442382-134442404 GGCCAGAGCGCAGGGACAAAAGG No data
1062050001_1062050011 18 Left 1062050001 9:134442367-134442389 CCCTCGGAGTTCTCAGGCCAGAG No data
Right 1062050011 9:134442408-134442430 AAGCTGAGGTCTGTGGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062050001 Original CRISPR CTCTGGCCTGAGAACTCCGA GGG (reversed) Intergenic