ID: 1062050005

View in Genome Browser
Species Human (GRCh38)
Location 9:134442382-134442404
Sequence GGCCAGAGCGCAGGGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062050002_1062050005 -9 Left 1062050002 9:134442368-134442390 CCTCGGAGTTCTCAGGCCAGAGC No data
Right 1062050005 9:134442382-134442404 GGCCAGAGCGCAGGGACAAAAGG No data
1062049991_1062050005 27 Left 1062049991 9:134442332-134442354 CCTCCACGGACACCCGTCCTTGG No data
Right 1062050005 9:134442382-134442404 GGCCAGAGCGCAGGGACAAAAGG No data
1062049995_1062050005 24 Left 1062049995 9:134442335-134442357 CCACGGACACCCGTCCTTGGGGT No data
Right 1062050005 9:134442382-134442404 GGCCAGAGCGCAGGGACAAAAGG No data
1062049997_1062050005 14 Left 1062049997 9:134442345-134442367 CCGTCCTTGGGGTGAGAGTGAGC No data
Right 1062050005 9:134442382-134442404 GGCCAGAGCGCAGGGACAAAAGG No data
1062050001_1062050005 -8 Left 1062050001 9:134442367-134442389 CCCTCGGAGTTCTCAGGCCAGAG No data
Right 1062050005 9:134442382-134442404 GGCCAGAGCGCAGGGACAAAAGG No data
1062049996_1062050005 15 Left 1062049996 9:134442344-134442366 CCCGTCCTTGGGGTGAGAGTGAG No data
Right 1062050005 9:134442382-134442404 GGCCAGAGCGCAGGGACAAAAGG No data
1062049998_1062050005 10 Left 1062049998 9:134442349-134442371 CCTTGGGGTGAGAGTGAGCCCTC No data
Right 1062050005 9:134442382-134442404 GGCCAGAGCGCAGGGACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062050005 Original CRISPR GGCCAGAGCGCAGGGACAAA AGG Intergenic