ID: 1062053555

View in Genome Browser
Species Human (GRCh38)
Location 9:134459244-134459266
Sequence CCTATGGGAGACCAGGATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062053542_1062053555 5 Left 1062053542 9:134459216-134459238 CCTGAACCCCTCGAAGGCCTCAT No data
Right 1062053555 9:134459244-134459266 CCTATGGGAGACCAGGATGGCGG No data
1062053541_1062053555 6 Left 1062053541 9:134459215-134459237 CCCTGAACCCCTCGAAGGCCTCA No data
Right 1062053555 9:134459244-134459266 CCTATGGGAGACCAGGATGGCGG No data
1062053543_1062053555 -1 Left 1062053543 9:134459222-134459244 CCCCTCGAAGGCCTCATCCCTCC No data
Right 1062053555 9:134459244-134459266 CCTATGGGAGACCAGGATGGCGG No data
1062053545_1062053555 -3 Left 1062053545 9:134459224-134459246 CCTCGAAGGCCTCATCCCTCCCT No data
Right 1062053555 9:134459244-134459266 CCTATGGGAGACCAGGATGGCGG No data
1062053540_1062053555 10 Left 1062053540 9:134459211-134459233 CCTGCCCTGAACCCCTCGAAGGC No data
Right 1062053555 9:134459244-134459266 CCTATGGGAGACCAGGATGGCGG No data
1062053544_1062053555 -2 Left 1062053544 9:134459223-134459245 CCCTCGAAGGCCTCATCCCTCCC No data
Right 1062053555 9:134459244-134459266 CCTATGGGAGACCAGGATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062053555 Original CRISPR CCTATGGGAGACCAGGATGG CGG Intergenic
No off target data available for this crispr