ID: 1062056894

View in Genome Browser
Species Human (GRCh38)
Location 9:134473503-134473525
Sequence GTGGGCTCCCTCACCTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062056884_1062056894 24 Left 1062056884 9:134473456-134473478 CCGTGATCACTCACTTTGGCTTC No data
Right 1062056894 9:134473503-134473525 GTGGGCTCCCTCACCTGGCCTGG No data
1062056891_1062056894 -8 Left 1062056891 9:134473488-134473510 CCCTAGCACAGGGCTGTGGGCTC No data
Right 1062056894 9:134473503-134473525 GTGGGCTCCCTCACCTGGCCTGG No data
1062056889_1062056894 -5 Left 1062056889 9:134473485-134473507 CCGCCCTAGCACAGGGCTGTGGG No data
Right 1062056894 9:134473503-134473525 GTGGGCTCCCTCACCTGGCCTGG No data
1062056892_1062056894 -9 Left 1062056892 9:134473489-134473511 CCTAGCACAGGGCTGTGGGCTCC No data
Right 1062056894 9:134473503-134473525 GTGGGCTCCCTCACCTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062056894 Original CRISPR GTGGGCTCCCTCACCTGGCC TGG Intergenic
No off target data available for this crispr