ID: 1062058791

View in Genome Browser
Species Human (GRCh38)
Location 9:134483428-134483450
Sequence GTCCATGTCCTTTCCGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062058786_1062058791 8 Left 1062058786 9:134483397-134483419 CCTTGGGTGCATTGGAGTAGAGG No data
Right 1062058791 9:134483428-134483450 GTCCATGTCCTTTCCGAGCCAGG No data
1062058785_1062058791 9 Left 1062058785 9:134483396-134483418 CCCTTGGGTGCATTGGAGTAGAG No data
Right 1062058791 9:134483428-134483450 GTCCATGTCCTTTCCGAGCCAGG No data
1062058782_1062058791 21 Left 1062058782 9:134483384-134483406 CCCTGAGGGTTGCCCTTGGGTGC No data
Right 1062058791 9:134483428-134483450 GTCCATGTCCTTTCCGAGCCAGG No data
1062058778_1062058791 28 Left 1062058778 9:134483377-134483399 CCCAGGACCCTGAGGGTTGCCCT No data
Right 1062058791 9:134483428-134483450 GTCCATGTCCTTTCCGAGCCAGG No data
1062058783_1062058791 20 Left 1062058783 9:134483385-134483407 CCTGAGGGTTGCCCTTGGGTGCA No data
Right 1062058791 9:134483428-134483450 GTCCATGTCCTTTCCGAGCCAGG No data
1062058777_1062058791 29 Left 1062058777 9:134483376-134483398 CCCCAGGACCCTGAGGGTTGCCC No data
Right 1062058791 9:134483428-134483450 GTCCATGTCCTTTCCGAGCCAGG No data
1062058779_1062058791 27 Left 1062058779 9:134483378-134483400 CCAGGACCCTGAGGGTTGCCCTT No data
Right 1062058791 9:134483428-134483450 GTCCATGTCCTTTCCGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062058791 Original CRISPR GTCCATGTCCTTTCCGAGCC AGG Intergenic
No off target data available for this crispr