ID: 1062059910

View in Genome Browser
Species Human (GRCh38)
Location 9:134489702-134489724
Sequence GGGTGGGTTGCTGCGGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062059903_1062059910 13 Left 1062059903 9:134489666-134489688 CCTGGGCTGATTGTGGTGGGTAA No data
Right 1062059910 9:134489702-134489724 GGGTGGGTTGCTGCGGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062059910 Original CRISPR GGGTGGGTTGCTGCGGATTG TGG Intergenic
No off target data available for this crispr