ID: 1062065209

View in Genome Browser
Species Human (GRCh38)
Location 9:134523077-134523099
Sequence CACGCTGCAGAGAGGGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062065209_1062065222 23 Left 1062065209 9:134523077-134523099 CCCGGCTCCCTCTCTGCAGCGTG No data
Right 1062065222 9:134523123-134523145 GGAGGCTGCAGCTCCTGTCAAGG No data
1062065209_1062065223 24 Left 1062065209 9:134523077-134523099 CCCGGCTCCCTCTCTGCAGCGTG No data
Right 1062065223 9:134523124-134523146 GAGGCTGCAGCTCCTGTCAAGGG No data
1062065209_1062065219 2 Left 1062065209 9:134523077-134523099 CCCGGCTCCCTCTCTGCAGCGTG No data
Right 1062065219 9:134523102-134523124 CAGGGATGTGGCACCTCGGCTGG No data
1062065209_1062065220 5 Left 1062065209 9:134523077-134523099 CCCGGCTCCCTCTCTGCAGCGTG No data
Right 1062065220 9:134523105-134523127 GGATGTGGCACCTCGGCTGGAGG No data
1062065209_1062065217 -2 Left 1062065209 9:134523077-134523099 CCCGGCTCCCTCTCTGCAGCGTG No data
Right 1062065217 9:134523098-134523120 TGGCCAGGGATGTGGCACCTCGG No data
1062065209_1062065216 -10 Left 1062065209 9:134523077-134523099 CCCGGCTCCCTCTCTGCAGCGTG No data
Right 1062065216 9:134523090-134523112 CTGCAGCGTGGCCAGGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062065209 Original CRISPR CACGCTGCAGAGAGGGAGCC GGG (reversed) Intergenic
No off target data available for this crispr