ID: 1062069852

View in Genome Browser
Species Human (GRCh38)
Location 9:134549784-134549806
Sequence CCCTCAGATGGCTGCCTCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062069852_1062069858 18 Left 1062069852 9:134549784-134549806 CCACCGAGGCAGCCATCTGAGGG No data
Right 1062069858 9:134549825-134549847 GGCTCTCTCACCCTTGCTGAAGG No data
1062069852_1062069856 -4 Left 1062069852 9:134549784-134549806 CCACCGAGGCAGCCATCTGAGGG No data
Right 1062069856 9:134549803-134549825 AGGGAAAGTGACATTTTCACTGG No data
1062069852_1062069857 -3 Left 1062069852 9:134549784-134549806 CCACCGAGGCAGCCATCTGAGGG No data
Right 1062069857 9:134549804-134549826 GGGAAAGTGACATTTTCACTGGG No data
1062069852_1062069859 19 Left 1062069852 9:134549784-134549806 CCACCGAGGCAGCCATCTGAGGG No data
Right 1062069859 9:134549826-134549848 GCTCTCTCACCCTTGCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062069852 Original CRISPR CCCTCAGATGGCTGCCTCGG TGG (reversed) Intergenic
No off target data available for this crispr