ID: 1062069857

View in Genome Browser
Species Human (GRCh38)
Location 9:134549804-134549826
Sequence GGGAAAGTGACATTTTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062069852_1062069857 -3 Left 1062069852 9:134549784-134549806 CCACCGAGGCAGCCATCTGAGGG No data
Right 1062069857 9:134549804-134549826 GGGAAAGTGACATTTTCACTGGG No data
1062069854_1062069857 -6 Left 1062069854 9:134549787-134549809 CCGAGGCAGCCATCTGAGGGAAA No data
Right 1062069857 9:134549804-134549826 GGGAAAGTGACATTTTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062069857 Original CRISPR GGGAAAGTGACATTTTCACT GGG Intergenic
No off target data available for this crispr