ID: 1062069858

View in Genome Browser
Species Human (GRCh38)
Location 9:134549825-134549847
Sequence GGCTCTCTCACCCTTGCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062069855_1062069858 6 Left 1062069855 9:134549796-134549818 CCATCTGAGGGAAAGTGACATTT No data
Right 1062069858 9:134549825-134549847 GGCTCTCTCACCCTTGCTGAAGG No data
1062069854_1062069858 15 Left 1062069854 9:134549787-134549809 CCGAGGCAGCCATCTGAGGGAAA No data
Right 1062069858 9:134549825-134549847 GGCTCTCTCACCCTTGCTGAAGG No data
1062069852_1062069858 18 Left 1062069852 9:134549784-134549806 CCACCGAGGCAGCCATCTGAGGG No data
Right 1062069858 9:134549825-134549847 GGCTCTCTCACCCTTGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062069858 Original CRISPR GGCTCTCTCACCCTTGCTGA AGG Intergenic
No off target data available for this crispr