ID: 1062073053

View in Genome Browser
Species Human (GRCh38)
Location 9:134568668-134568690
Sequence CAGCCCAAAGACTCTGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062073040_1062073053 6 Left 1062073040 9:134568639-134568661 CCCTCTGACCCCAAGGAGGTTCC No data
Right 1062073053 9:134568668-134568690 CAGCCCAAAGACTCTGGAGGGGG No data
1062073041_1062073053 5 Left 1062073041 9:134568640-134568662 CCTCTGACCCCAAGGAGGTTCCC No data
Right 1062073053 9:134568668-134568690 CAGCCCAAAGACTCTGGAGGGGG No data
1062073042_1062073053 -2 Left 1062073042 9:134568647-134568669 CCCCAAGGAGGTTCCCCTAGCCA No data
Right 1062073053 9:134568668-134568690 CAGCCCAAAGACTCTGGAGGGGG No data
1062073036_1062073053 15 Left 1062073036 9:134568630-134568652 CCTTAGAGCCCCTCTGACCCCAA No data
Right 1062073053 9:134568668-134568690 CAGCCCAAAGACTCTGGAGGGGG No data
1062073043_1062073053 -3 Left 1062073043 9:134568648-134568670 CCCAAGGAGGTTCCCCTAGCCAG No data
Right 1062073053 9:134568668-134568690 CAGCCCAAAGACTCTGGAGGGGG No data
1062073044_1062073053 -4 Left 1062073044 9:134568649-134568671 CCAAGGAGGTTCCCCTAGCCAGC No data
Right 1062073053 9:134568668-134568690 CAGCCCAAAGACTCTGGAGGGGG No data
1062073039_1062073053 7 Left 1062073039 9:134568638-134568660 CCCCTCTGACCCCAAGGAGGTTC No data
Right 1062073053 9:134568668-134568690 CAGCCCAAAGACTCTGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062073053 Original CRISPR CAGCCCAAAGACTCTGGAGG GGG Intergenic
No off target data available for this crispr