ID: 1062075866

View in Genome Browser
Species Human (GRCh38)
Location 9:134589721-134589743
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062075866_1062075881 28 Left 1062075866 9:134589721-134589743 CCAGCCTCATCCTGATACCTGCA No data
Right 1062075881 9:134589772-134589794 GTACTCCTGGGGGTCCAGGGTGG No data
1062075866_1062075871 15 Left 1062075866 9:134589721-134589743 CCAGCCTCATCCTGATACCTGCA No data
Right 1062075871 9:134589759-134589781 GCCCCTCACCTGTGTACTCCTGG No data
1062075866_1062075873 16 Left 1062075866 9:134589721-134589743 CCAGCCTCATCCTGATACCTGCA No data
Right 1062075873 9:134589760-134589782 CCCCTCACCTGTGTACTCCTGGG No data
1062075866_1062075883 30 Left 1062075866 9:134589721-134589743 CCAGCCTCATCCTGATACCTGCA No data
Right 1062075883 9:134589774-134589796 ACTCCTGGGGGTCCAGGGTGGGG No data
1062075866_1062075875 17 Left 1062075866 9:134589721-134589743 CCAGCCTCATCCTGATACCTGCA No data
Right 1062075875 9:134589761-134589783 CCCTCACCTGTGTACTCCTGGGG No data
1062075866_1062075880 25 Left 1062075866 9:134589721-134589743 CCAGCCTCATCCTGATACCTGCA No data
Right 1062075880 9:134589769-134589791 TGTGTACTCCTGGGGGTCCAGGG No data
1062075866_1062075877 18 Left 1062075866 9:134589721-134589743 CCAGCCTCATCCTGATACCTGCA No data
Right 1062075877 9:134589762-134589784 CCTCACCTGTGTACTCCTGGGGG No data
1062075866_1062075879 24 Left 1062075866 9:134589721-134589743 CCAGCCTCATCCTGATACCTGCA No data
Right 1062075879 9:134589768-134589790 CTGTGTACTCCTGGGGGTCCAGG No data
1062075866_1062075882 29 Left 1062075866 9:134589721-134589743 CCAGCCTCATCCTGATACCTGCA No data
Right 1062075882 9:134589773-134589795 TACTCCTGGGGGTCCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062075866 Original CRISPR TGCAGGTATCAGGATGAGGC TGG (reversed) Intergenic