ID: 1062075869

View in Genome Browser
Species Human (GRCh38)
Location 9:134589738-134589760
Sequence GCAGGCAGAAAGAGCAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062075869_1062075884 14 Left 1062075869 9:134589738-134589760 CCTGCATTGCTCTTTCTGCCTGC No data
Right 1062075884 9:134589775-134589797 CTCCTGGGGGTCCAGGGTGGGGG No data
1062075869_1062075875 0 Left 1062075869 9:134589738-134589760 CCTGCATTGCTCTTTCTGCCTGC No data
Right 1062075875 9:134589761-134589783 CCCTCACCTGTGTACTCCTGGGG No data
1062075869_1062075882 12 Left 1062075869 9:134589738-134589760 CCTGCATTGCTCTTTCTGCCTGC No data
Right 1062075882 9:134589773-134589795 TACTCCTGGGGGTCCAGGGTGGG No data
1062075869_1062075880 8 Left 1062075869 9:134589738-134589760 CCTGCATTGCTCTTTCTGCCTGC No data
Right 1062075880 9:134589769-134589791 TGTGTACTCCTGGGGGTCCAGGG No data
1062075869_1062075881 11 Left 1062075869 9:134589738-134589760 CCTGCATTGCTCTTTCTGCCTGC No data
Right 1062075881 9:134589772-134589794 GTACTCCTGGGGGTCCAGGGTGG No data
1062075869_1062075879 7 Left 1062075869 9:134589738-134589760 CCTGCATTGCTCTTTCTGCCTGC No data
Right 1062075879 9:134589768-134589790 CTGTGTACTCCTGGGGGTCCAGG No data
1062075869_1062075873 -1 Left 1062075869 9:134589738-134589760 CCTGCATTGCTCTTTCTGCCTGC No data
Right 1062075873 9:134589760-134589782 CCCCTCACCTGTGTACTCCTGGG No data
1062075869_1062075871 -2 Left 1062075869 9:134589738-134589760 CCTGCATTGCTCTTTCTGCCTGC No data
Right 1062075871 9:134589759-134589781 GCCCCTCACCTGTGTACTCCTGG No data
1062075869_1062075877 1 Left 1062075869 9:134589738-134589760 CCTGCATTGCTCTTTCTGCCTGC No data
Right 1062075877 9:134589762-134589784 CCTCACCTGTGTACTCCTGGGGG No data
1062075869_1062075883 13 Left 1062075869 9:134589738-134589760 CCTGCATTGCTCTTTCTGCCTGC No data
Right 1062075883 9:134589774-134589796 ACTCCTGGGGGTCCAGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062075869 Original CRISPR GCAGGCAGAAAGAGCAATGC AGG (reversed) Intergenic
No off target data available for this crispr