ID: 1062075870

View in Genome Browser
Species Human (GRCh38)
Location 9:134589756-134589778
Sequence GGAGTACACAGGTGAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1062075870_1062075884 -4 Left 1062075870 9:134589756-134589778 CCTGCCCCTCACCTGTGTACTCC No data
Right 1062075884 9:134589775-134589797 CTCCTGGGGGTCCAGGGTGGGGG No data
1062075870_1062075882 -6 Left 1062075870 9:134589756-134589778 CCTGCCCCTCACCTGTGTACTCC No data
Right 1062075882 9:134589773-134589795 TACTCCTGGGGGTCCAGGGTGGG No data
1062075870_1062075880 -10 Left 1062075870 9:134589756-134589778 CCTGCCCCTCACCTGTGTACTCC No data
Right 1062075880 9:134589769-134589791 TGTGTACTCCTGGGGGTCCAGGG No data
1062075870_1062075883 -5 Left 1062075870 9:134589756-134589778 CCTGCCCCTCACCTGTGTACTCC No data
Right 1062075883 9:134589774-134589796 ACTCCTGGGGGTCCAGGGTGGGG No data
1062075870_1062075881 -7 Left 1062075870 9:134589756-134589778 CCTGCCCCTCACCTGTGTACTCC No data
Right 1062075881 9:134589772-134589794 GTACTCCTGGGGGTCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1062075870 Original CRISPR GGAGTACACAGGTGAGGGGC AGG (reversed) Intergenic
No off target data available for this crispr